Assay kits are used to carry out analyses in a broad scope of applications including the study of targets such as drugs, molecules, disease pathways, chemical elements or compounds, and organisms. They are a routine procedure in the modern pharmaceutical, medical and forensic world as well as research and university laboratories around the globe. Assay kits come with all the necessary reagents, instructions and protocols for fast and efficient processing, allowing for repeatable results.
|  | | | | |
| Company | Aladdin Scientific Corporation | Aladdin Scientific Corporation | Aladdin Scientific Corporation | Aladdin Scientific Corporation | Aladdin Scientific Corporation |
| Item | Magnetic Bead-Based DNA Extraction Kit for Polysaccharide- and Polyphenol-Rich Plant Samples | Endo F Multi-Kit | Mouse Immunohistochemistry Kit (HRP Polymer) | NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) | Nuclear and Cytoplasmic Protein Extraction Kit |
| Catalog Number | M1373546 | E489822 | M777874 | N666055 | N778382 |
| Price | Supplier Page | Supplier Page | Supplier Page | Supplier Page | Supplier Page |
| Description | Inquire | The Endo F Multi-Kit will deglycosylate N-linked glycans in both native and denatured conditions. Each enzyme has a distinct specificity for N-linked glycan release. One can choose to use the three enzymes in combination to completely remove all N-linked glycans present on a glycoprotein or peptide,The Endo F Multi-Kit will deglycosylate N-linked glycans in both native and denatured conditions. Each enzyme has a distinct specificity for N-linked glycan release. One can choose to use the three enzymes in combination to completely remove all N-linked glycans present on a glycoprotein or peptide, or to use each enzyme independently and thereby determine the type of N-glycans present.Product DescriptionThe Endo F Multi-kit is recommended to deglycosylate native proteins that are resistant to PNGase F cleavage under non-denatured conditions due to the glycan location within the protein’s three-dimensional structure, as these enzymes are known to be less sensitive to protein conformation.Each of the enzymes has a different N-linked glycan specificity:Endoglycosidase F1 cleaves high mannose and some hybrid type N-glycansEndoglycosidase F2 releases biantennary and high mannose glycans (at a 40X reduced rate)Endoglycosidase F3 will release triantennarry and fucosylated biantennary N-glycansContents1 vial: Endo F1- 20 µl (0.3 U)20 mM Tris-HCl pH 7.51 vial: Endo F2- 20 µl (0.1 U)10 mM sodium acetate, 25 mM NaCl, pH 4.51 vial: Endo F3- 20 µl (0.1 U)20 mM Tris-HCl pH 7.51 vial: 5x Reaction Buffer - 400 µl250 mM sodium acetate, pH4.51 vial: 5x Reaction Buffer - 400 µl250 mM sodium phosphate, pH5.5Specific ActivityDefined as the amount of enzyme required to catalyze the release of N-linked oligosaccharides from 1 micro-mole of denatured Ribonuclease B (Endo F1) or porcine fibrinogen peptides (Endo F2/F3) in 1 minute at 37°C, pH 5.5 (PH 4.5 for Endo F3). Cleavage is monitored by SDS-PAGE.FormulationThe enzymes are provided as a sterile-filtered solution.StabilitySeveral days exposure to ambient temperatures will not reduce activity. Stable at least 12 months when stored properly.SpecificityEndo F1 cleaves Asparagine-linked (N-linked) high mannose or hybrid oligosaccharides. Endo F2 cleaves N-linked biantennary oligosaccharides and high mannose (at a 40X reduced rate). Endo F3 cleaves free or N-linked fucosylated biantennary or triantennary oligosaccharides,as well as triamannosylchitobiose core structures. These enzymes cleave between the two N-acetylglucosamine residues in the diacetylchitobiose core of the oligosaccharide, generating a truncated sugar molecule with one N-acetylglucosamine residue remaining on the asparagine. The recombinant version is not glycosylated, which may result in properties differing from the native protein.Quality & PurityEndo F1, Endo F2, and Endo F3 are tested for contaminating protease as follows: 10 µg of denatured BSA is incubated at 37°C for 24 hours with 2 µl of enzyme. SDS-PAGE analysis of the treated BSA shows no evidence of degradation. The absence of exoglycosidase contaminants is confirmed by extended incubations with the corresponding pNP-glycosides. Directions for use 1. Add up to 200 µg of glycoprotein to an Eppendorf tube. Adjust to 34 µl final volume with de-ionized water. 2. Add 10 µl Endo F2 &F3 5x Reaction Buffer, 250 mM sodium acetate pH 4.5. Use Endo F1 buffer, 250 mM sodium phosphate pH 5.5 if you are using the Endo F1 enzyme alone. 4. Add 2.0 µl of each enzyme to the reaction. Incubate 3 hours at 37°C. Monitor cleavage by SDS-PAGE. Applications– Deglycosylation of native proteins resistant to PNGase F cleavage– Determination of glycan type (high mannose, biantennary, tri/tetrantennary)– Deglycosylating proteins which normally precipitate when deglycosylating– X-Ray CrystallographyThese three enzymes cleave asparagine-linked (N-linked) oligosaccharides between the two GlcNAc residues in the core of the oligosaccharide, generating a truncated sugar molecule with one N-acetylglucosamine residue remaining on the asparagine, enhancing the solubility of the protein. In contrast, PNGase F removes the oligosaccharide intact... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire |
| Get Quote | Supplier Page | Supplier Page | Supplier Page | Supplier Page | Supplier Page |