| Description | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Alanine Aminotransferase (ALT), also known as serum glutamic-pyruvic transaminase (SGPT), is a pyridoxal-phosphate-dependent enzyme that catalyzes the reversible transfer of an amino group from alanine to α-ketoglutarate, generating pyruvate and glutamate. ALT is found primarily in liver and Alanine Aminotransferase (ALT), also known as serum glutamic-pyruvic transaminase (SGPT), is a pyridoxal-phosphate-dependent enzyme that catalyzes the reversible transfer of an amino group from alanine to α-ketoglutarate, generating pyruvate and glutamate. ALT is found primarily in liver and serum, but occurs in other tissues as well. Hepatocellular injury often results in an increase of serum ALT levels and serum ALT levels can be used as a marker for liver injury.ALT Activity Assay kit has been used to determine the activity of alanine aminotransferase (ALT) in serum samples... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product introduction：Griess reagent can be used for spectrophotometric detection of nitrite. The reagent contains two chemicals, sulfonic acid and n- (1-naphthyl) ethylenediamine. Under acidic conditions, sulfamic acid is converted into diazonium salt by nitrite, which can form a highly Product introduction：Griess reagent can be used for spectrophotometric detection of nitrite. The reagent contains two chemicals, sulfonic acid and n- (1-naphthyl) ethylenediamine. Under acidic conditions, sulfamic acid is converted into diazonium salt by nitrite, which can form a highly colored azo dye with n- (1-naphthyl) ethylenediamine. This dye can be detected at 548 nm: because no is extremely unstable, it is oxidized to form nitrite and nitrate. Griess indirectly reflects the content of no by detecting the content of nitrite.Matters needing attention：1. before using Griess reagent, return it to room temperature and check the solution for precipitation. If Griess reagent I contains sediment when taken out, it can be placed in a 37 ℃ water bath until the sediment dissolves. 2. this product is potentially harmful. Avoid prolonged or repeated exposure. Avoid entering eyes, skin or clothing. Please wear lab clothes and disposable gloves for operation.Scope of application：No detectionComponent：Instruction：1.Griess Reagent I and II were taken out to restore the room temperature.2.Standard dilution : The standard NaNO2 ( 1-100 µM ) was diluted with the solution used for the sample to be tested. The standard was diluted to 1 µM, 10 µM, 20 µM, 40 µM, 80 µM and 100 µM, and 100 µL standard was added to each well. If the sample concentration is too low, the range of the standard curve can be appropriately reduced ( 1 µM, 2 µM, 3 µM, 4 µM, 6 µM, 8 µM, 10 µM ).3.Sample detection :( 1 ) According to the total volume of 200 µL / hole, 100 µL / hole sample was added to the 96-well plate ; if the sample is the supernatant of the culture medium, it can be sampled directly, and if there is sediment, the supernatant should be taken after centrifugation. If the sample is a cell or tissue, it can be quickly lysed by freeze-thaw, and then centrifuged to obtain the supernatant. The volume of less than 100 µL can be diluted with diH2O or 0.9 % NaCl ( corresponding standards also need to be diluted with diH2O or 0.9 % NaCl ).( 2 ) According to 50 µL / hole, Griess Reagent I was added to each hole.( 3 ) According to 50 µL / hole, Griess Reagent II was added to each hole.( 4 ) The absorbance was measured at 540 nm. If there is no 540 nm filter, 520-560 nm filter can also be. If there is no microplate reader or a suitable filter, the concentration of nitric oxide in the sample can also be determined by visual colorimetry. A more precise concentration gradient is required for the standard when visual colorimetric... Read More | Product Content R669990Component50 TStorageR669990ADNase I1000 U-20℃. Avoid freeze/thaw cycle.R669990B10×Reaction Buffer1 mL-20℃. Avoid freeze/thaw cycle.R669990CBuffer RL35 mLRTR669990DBuffer RW135 mLRTR669990EBuffer RW2 (concentrate)11 mLRTR669990FRNase-Free Water10 Product Content R669990Component50 TStorageR669990ADNase I1000 U-20℃. Avoid freeze/thaw cycle.R669990B10×Reaction Buffer1 mL-20℃. Avoid freeze/thaw cycle.R669990CBuffer RL35 mLRTR669990DBuffer RW135 mLRTR669990EBuffer RW2 (concentrate)11 mLRTR669990FRNase-Free Water10 mLRTR669990GSpin Columns RM with Collection Tubes50 setsRTR669990HRNase-Free Centrifuge Tubes (1.5 mL)50 EART ProductsThis kit combines highly efficient guanidine isothiocyanate cleavage technology with silica matrix membrane purification for the efficient extraction of total RNA from animal cells and tissues, typically up to 30 mg of tissue or 1x107 cells as a starting sample. The kit also allows recovery of incompletely purified RNA, in vitro transcription and RNA from enzymatic reactions. high quality RNA with molecular weights greater than 200 bases can be extracted and purified using the kit with virtually no DNA residue. If RNA experiments that are very sensitive to trace DNA are to be performed, residual DNA can be removed by on-column digestion using RNase-free DNase. The extracted RNA can be used in downstream experiments such as RT-PCR, Nothern Blot and Dot Blot. Self-contained reagents: β-mercaptoethanol, anhydrous ethanol (freshly opened or for RNA extraction).Pre-experiment Preparation and Important Notes1. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.2) RNase-free water should be used to prepare the solution.(3) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.2. Avoid repeated freezing and thawing of the extracted samples, otherwise it will affect the amount and quality of RNA extraction.3. Please add β-mercaptoethanol to Buffer RL before use, add 10µl of β-mercaptoethanol to 1ml of Buffer RL. Buffer RL with β-mercaptoethanol can be stored for 1 month at room temperature.4. Anhydrous ethanol should be added to Buffer RW2 before first use according to the instructions on the reagent bottle label.5. Buffer RL may be heated at 56°C to dissolve if precipitation occurs and then left at room temperature.All centrifugation steps are performed at room temperature and all maneuvers are performed quickly.Procedure1. Sample handling1a Tissue: Grind tissue in liquid nitrogen. Add 600 µl Buffer RL for every 20-30 mg of tissue (check for addition of β-mercaptoethanol before use), and 350 µl Buffer RL for tissue samples of less than 20 mg. Sample volume is not to exceed one-tenth of the Buffer RL volume.1b Cells in monolayer culture: Lysed or processed into cell suspension directly in culture flask, centrifuged to obtain cell precipitate, discarded the supernatant, added 600µl Buffer RL for every 6-10 cm2 of culture area, 350µl Buffer RL for less than 6cm2, and blown several times repeatedly to make the cells lysed sufficiently.1c Cell suspension: centrifuge at 12,000 rpm (~13,400 × g) for 1 min and discard the supernatant to obtain the cell precipitate. Add 600 µl Buffer RL for every 5×106-1×107 cells, and 350 µl Buffer RL for less than 5×106 cells, and blow several times repeatedly to fully lysate.Note: 1) Try to get rid of the cell culture medium, which may inhibit cell lysis affecting RNA yield.2) Try to keep the cells well suspended and well lysed, otherwise RNA yield is affected.2. After the sample is fully lysed, leave it at room temperature for 5 minutes to allow complete separation of the protein-nucleic acid complex.3. Centrifuge at 12,000 rpm for 2-5 min and remove the supernatant for the following operations.4. Add 1x volume (600µl or 350µl) of 70% ethanol (prepared without RNase water) to the solution obtained in step 3 and mix well.Note: The addition of ethanol may produce a precipitate that will not affect subsequent experiments.5. Add all of the solution obtained in the previous step to the Spin Columns RM in the collection tube. If you cannot add all of the solution to the column at once, transfer it in two passes, centrifuge at 12,000 rpm for 1 minute, and discard the waste solution. Place the column back into the collection tube.Note: The maximum loading capacity of the adsorption column is 100µg, do not overload as this will affect the yield and purity of the RNA.6. Add 350 µl Buffer RW1 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid and put the adsorbent column back into the collection tube.7. Preparation of DNase I mixture: Take 52 µl of RNase-Free Water, add 8 µl of 10×Reaction Buffer and 20 µl of DNase I (1 U/µl) to it, mix well, and prepare a final volume of 80 µl of reaction solution.8. Add 80µl of DNase I mixture directly to the adsorption column and incubate at 20-30°C for 15 minutes.9. Add 200 µl Buffer RW1 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid and put the adsorbent column back into the collection tube.10. Add 500µl Buffer RW2 to the column (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the column back into the collection tube.11. Repeat step 10.12. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for a few minutes to thoroughly dry the anhydrous ethanol in the adsorption column.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).13. Transfer the adsorbent column into a new centrifuge tube, add 30-50 µl of RNase-Free Water to the middle of the adsorbent membrane, leave it at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, collect the RNA solution, and store the RNA at -70°C to prevent degradation.Note: 1) The volume of RNase-Free Wate should not be less than 30 µl, too small volume affects the recovery rate.2) If you want to increase the RNA yield, repeat step 13 with 30-50 µl of fresh RNase-Free Water.3) If the RNA concentration is to be increased, the resulting solution can be reintroduced into the adsorption column and step 13 repeated... Read More |