| Description | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Inquire | Product DescriptionOur Glycan Sequencing Kit includes the enzymes and buffer required to sequence ten N-linked oligosaccharides.ContentsNeuraminidase from Arthrobacter ureafaciens – 80 µlBeta-Galactosidase from Streptococcus pneumoniae – 60 µlN-Acetylglucosaminidase from Product DescriptionOur Glycan Sequencing Kit includes the enzymes and buffer required to sequence ten N-linked oligosaccharides.ContentsNeuraminidase from Arthrobacter ureafaciens – 80 µlBeta-Galactosidase from Streptococcus pneumoniae – 60 µlN-Acetylglucosaminidase from Streptococcus pneumoniae) – 40 µlAlpha-Mannosidase from Jack Bean – 20 µlCore Alpha-Mannosidase from X. manihotis) – 10 µl5X Reaction buffer – 400 µlAnalysisMany methods of analysis are available, including HPLC, gel electrophoresis, HPAEC, capillary electrophoresis, and mass spectrometry. For more information on these methods, please contact us.StabilityThe Glycan Sequencing Kit is stable at least 12 months when stored properly. Several days exposure to ambient temperatures will not reduce activity.PurityAll Enzymes are tested for contaminating protease by incubating 10 µg of denatured BSA with 2 µl of enzyme at 37°C for 24 hours. SDS-PAGE analysis of the treated BSA shows no evidence of degradation.The production host strains for our recombinant enzymes have been extensively tested and do not produce any detectable glycosidases. Enzymes purified from native sources are tested for contaminating exoglycosidases The absence of exoglycosidase contaminants is confirmed by extended incubations with the corresponding pNP-glycosides... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665737Component24 T96 TStorageN665737ATPS V50 168 µL672 µL-20℃. Avoid freeze/thaw cycle.N665737B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665737CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665737D2×Products contentN665737Component24 T96 TStorageN665737ATPS V50 168 µL672 µL-20℃. Avoid freeze/thaw cycle.N665737B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665737CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665737D2×PCR Mix600 µL2×1.2 mL-20℃. Avoid freeze/thaw cycle. * This kit is suitable for human genomic DNA library construction, the starting template DNA input is 5 ng. We also have transposase library construction kits for 50 ng and 1 ng of human genomic DNA starting, in order to get a higher quality library, it is recommended to use different kits for different starting amount of DNA. Products IntroductionThis kit is developed for Illumina's high-throughput sequencing platform and provides the enzyme premix system and reaction buffer for genomic DNA library construction, including all components except PCR primers. Compared with the traditional library construction kits, this kit adopts the new transposase method for library construction, which can complete DNA fragmentation, end repair and junction reaction in one simple enzymatic reaction, significantly reducing the amount of template, reducing the number of experimental steps, and shortening the time of library construction; it adopts the high-fidelity DNA polymerase for library enrichment, and the preference-free PCR amplification can expand the coverage area of the sequence, which can be used for efficient and effective sequencing. The use of high-fidelity DNA polymerase for library enrichment and preference-free PCR amplification broadens the coverage area of the sequence and enables efficient preparation of DNA libraries for Illumina's second-generation sequencing platform. The kit is suitable for use with a starting template DNA input of 5 ng, and all reagents in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. Product Features● DNA fragmentation and junction ligation in one step.● Ultra-fidelity amplification minimizes amplification preference.Provide your own instruments, kits and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use DNA purification and recovery kit by magnetic bead method.3. Library PCR primer kit: It is recommended to use transposase method for second generation sequencing multi-sample primer kit.4. Anhydrous ethanol, deionized water (pH between 7.0 and 8.0).5. Reaction tubes: It is recommended to use low adsorption PCR tubes and 1.5 ml centrifuge tubes. Tips: It is recommended to use high quality filter tips to prevent contamination of kits and library samples. Pre-experiment Preparation and Important Notes1. Avoid repeated freezing and thawing of reagents.2. PCR products are easily contaminated due to improper operation, resulting in inaccurate results. It is recommended to isolate the PCR reaction system preparation area from the PCR product purification area, and to use special pipettes to clean the experimental areas at regular intervals.3. Bead purification: the beads should be equilibrated to room temperature before use, all operations on the beads should be carried out at room temperature, 80% ethanol should be dispensed freshly, the beads should be rinsed and dried until the surface is free of liquid reflections and has a frosted appearance, insufficient drying of the beads will cause ethanol residue that will affect the subsequent experiments, and over-drying of the beads will affect the efficiency of DNA recovery.4. The kit is suitable for human genomic DNA library construction, if the DNA sample is a PCR product, it should be ensured that its length>.500 bp, since transposases do not work on DNA ends, it is recommended to extend the PCR product by 50-100 bp at each end of the PCR product to avoid low coverage of the ends for sequencing. Sample PreparationDNA purity requirements: A260/A280 = 1.8-2.0. Sample DNA: dissolve in ultrapure water. DNA Quantification: Too much or too little DNA will affect the quality of the library. It is recommended to use Nano to test the purity of the genomic DNA and then use Qubit to test the concentration of the genome (do not use any absorbance-based assay for template quantification). Schematic diagram of DNA banking processprocedureDNA fragmentation, junction reaction 1. Add the following reagents to a 200 µl PCR tube: 2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows: inactivation reactionAfter the DNA is fragmented, the enzyme is still in a high active state, so it should be removed from the PCR instrument immediately and terminated by adding the Reaction Termination Buffer, in order to prevent the DNA from being fragmented too much and resulting in smaller library fragments.1. Add 3 µl of TS Buffer to the PCR tube containing the fragmentation product.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Incubate at room temperature for 5 min, or if the room temperature is too low, place the reaction on a PCR instrument at 25°C with the thermal cover closed.1. Add the following reagents to a 200 µl PCR tube.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows Selective recovery of library DNA fragmentsIt is recommended to use CombiVision Magnetic Beads DNA Purification and Recovery Kit for selective recovery of DNA fragments. When different sizes of DNA fragments are required, the amount of magnetic beads used is different, please refer to the attached table for the specific amount of magnetic beads used.(If using other brands of magnetic beads, you need to figure out the optimal amount of magnetic beads by yourself).Note: Amplification products can also be fragment length sorted and purified using the Gum Recovery Kit. If there is no special requirement for library length distribution, amplification products can also be purified directly from DNA fragments without selective recovery of DNA fragments as described on page 4 of the manual.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. Transfer the PCR products to a 1.5 ml centrifuge tube, rehydrate to 100 µl, add several volumes of magnetic beads equilibrated to room temperature, vortex for 5 seconds, and let stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, and carefully aspirate the supernatant and transfer it to a new 1.5 ml centrifuge tube.Note: Do not discard the top clear.4. Add several volumes of magnetic beads to the supernatant, vortex and shake for 5 seconds, then let stand at room temperature for 5 minutes.5. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA.Note: Do not discard the beads.6. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.7. Repeat step 6 once.8. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 20 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.9. Remove the centrifuge tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new centrifuge tube. Table: Suggested amount of magnetic beads for different segment selection recovery Library DNA fragment purificationWe recommend the use of the Century Magnetic Bead Method DNA Purification and Recovery Kit.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. 50 µl of magnetic beads equilibrated to room temperature were added to the PCR product, vortexed and shaken for 5 seconds, and then left to stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant solution until the solution is clear (approximately 3-5 minutes), carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA. Note: Do not discard the beads.4. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the centrifuge tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.5. Repeat step 4.6. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 25 µl of ddH O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.7. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new tube. Library quality controlDetermination of library concentrationIn order to obtain high-quality sequencing results, accurate quantification of DNA libraries is required, and the first recommendation is to use Real-timePCR methods are used for absolute quantification of DNA libraries. Additionally, fluorescent dye methods such as the Qubit method or the fluorescent dye picogreen method can be used; do not use quantification methods based on absorbance measurements here. The following approximate formula can be used to convert the molar concentration of the DNA library. Library fragment distributionThe prepared DNA libraries can be detected by agarose gel electrophoresis or Agilent 2100 Bioanalyzer.Range of segment length distributions... Read More |