| Description | Glucokinase (GK, EC 2.7.1.2) is a member of the hexokinase family, primarily found in mature hepatocytes and pancreatic islet cells. Under normal physiological conditions, the main role of GK is to monitor blood glucose levels. Detection Principle: Glucokinase (GK) phosphorylates glucose to produce Glucokinase (GK, EC 2.7.1.2) is a member of the hexokinase family, primarily found in mature hepatocytes and pancreatic islet cells. Under normal physiological conditions, the main role of GK is to monitor blood glucose levels. Detection Principle: Glucokinase (GK) phosphorylates glucose to produce glucose-6-phosphate. This product is further coupled with glucose-6-phosphate dehydrogenase and NADP⁺. The increase in NADPH absorbance at 340 nm is measured, allowing for the calculation of the enzyme's activity.Component100TStorageExtraction Buffer120 mL2-8℃Reagent 120 mL2-8℃Reagent 21EA-20℃Reagent 31EA2-8℃Reagent 2 (Powder, 1 vial) Preparation:Before use, centrifuge at 8000 g, 4°C for 2 minutes to collect the powder at the bottom of the tube (can be flicked manually).Add 1.1 mL of distilled water to dissolve. Use after preparation.The prepared solution can be stored for the duration of the kit's validity period.Reagent 3 (Powder, 1 vial) Preparation:Before opening, ensure the powder is at the bottom (can be flicked manually).Add 18 mL of Reagent 1 to dissolve. Use after preparation.The prepared solution can be stored for the duration of the kit's validity period.User-Prepared Instruments and MaterialsMortar (Homogenizer), Ice box (Ice maker), Benchtop centrifuge, Adjustable micropipettes, Water bath (Oven, Incubator, Metal bath), 96-well plate, Centrifuge tubes, Microplate reader, Distilled water (Deionized water or Ultrapure water are also acceptable).Experimental ProcedureIt is recommended to first perform a preliminary test using 1-3 samples with expected significant differences (e.g., different types or groups) to familiarize yourself with the procedure and to determine or adjust sample concentrations based on the preliminary results, preventing unnecessary waste of samples or reagents.1. Sample Extraction1.1 Tissue SamplesWeigh approximately 0.1 g of tissue. Add 1 mL of Extraction Buffer and homogenize in an ice bath. Centrifuge at 12,000 rpm, 4°C for 10 minutes. Collect the supernatant and keep it on ice for assay.Note: If increasing the sample amount, maintain a tissue mass (g) to Extraction Buffer volume (mL) ratio between 1:5 and 1:10.1.2 Bacterial/Cell SamplesCollect bacteria or cells into a centrifuge tube, centrifuge, and discard the supernatant. Add 1 mL of Extraction Buffer per 5 million bacteria/cells. Disrupt the bacteria or cells by sonication in an ice bath (power 20% or 200W, pulse 3s on, 10s off, repeat 30 times). Centrifuge at 12,000 rpm, 4°C for 10 minutes. Collect the supernatant and keep it on ice for assay.Note: If increasing the sample amount, maintain a bacteria/cell count (10⁴) to Extraction Buffer volume (mL) ratio between 500:1 and 1000:1.1.3 Liquid SamplesAssay directly. If turbid, centrifuge and use the supernatant for assay.2. Assay Steps2.1 Preheat the microplate reader for at least 30 minutes. Set the wavelength to 340 nm.2.2 Pre-warm the prepared Reagent 2 and Reagent 3 at 25°C for 5 minutes to reach room temperature.2.3 Add reagents sequentially to a 96-well plate:ReagentTest Well (µL)Sample20Reagent 210Reagent 3170Mix thoroughly. Read the absorbance at 340 nm at 1 minute (A₁) and again at 21 minutes (A₂, i.e., after 20 minutes of reaction). Calculate ΔA = A₂ - A₁.Note:If ΔA is close to zero, the reaction time can be appropriately extended to 30 minutes or longer before reading A₂. If the reaction time is changed, the new time (T) must be substituted into the calculation formula. Alternatively, the sample volume can be increased; the new sample volume (V₁) must then be substituted into the calculation formula.If the increase trend is unstable, read the absorbance every 10 seconds and select a linearly increasing time period for calculation. The corresponding A values for this period should be used to calculate ΔA and substituted into the formula.3. Calculation of Results3.1 Based on Sample Protein ConcentrationUnit Definition: One unit of enzyme activity is defined as the amount that produces 1 nmol of NADPH per minute per mg of tissue protein.Derived Formula: GK (nmol/min/mg prot) = [ΔA ÷ (ε × d) × V₂ × 10⁹] ÷ (V₁ × Cpr) ÷ TSimplified Formula: GK (nmol/min/mg prot) = 160.77 × ΔA ÷ Cpr3.2 Based on Sample Fresh WeightUnit Definition: One unit of enzyme activity is defined as the amount that produces 1 nmol of NADPH per minute per gram of tissue.Derived Formula: GK (nmol/min/g fresh weight) = [ΔA ÷ (ε × d) × V₂ × 10⁹] ÷ (W × V₁ ÷ V) ÷ TSimplified Formula: GK (nmol/min/g fresh weight) = 160.77 × ΔA ÷ W3.3 Based on Bacterial or Cell DensityUnit Definition: One unit of enzyme activity is defined as the amount that produces 1 nmol of NADPH per minute per 10⁴ bacteria or cells.Derived Formula: GK (nmol/min/10⁴ cells) = [ΔA ÷ (ε × d) × V₂ × 10⁹] ÷ (500 × V₁ ÷ V) ÷ TSimplified Formula: GK (nmol/min/10⁴ cells) = 0.32 × ΔA3.4 Based on Liquid VolumeUnit Definition: One unit of enzyme activity is defined as the amount that produces 1 nmol of NADPH per minute per mL of liquid.Derived Formula: GK (nmol/min/mL) = [ΔA ÷ (ε × d) × V₂ × 10⁹] ÷ V₁ ÷ TSimplified Formula: GK (nmol/min/mL) = 160.77 × ΔAParameter Definitions:ε: Molar extinction coefficient of NADPH (6.22 × 10³ L/mol/cm)d: Light path length for the 96-well plate (0.5 cm)V: Volume of Extraction Buffer added (1 mL)V₁: Volume of sample added to the reaction (0.02 mL)V₂: Total volume of the reaction system (0.2 mL = 2.0 × 10⁻⁴ L)T: Reaction time (20 minutes)W: Sample weight (g)500: Total number of bacteria or cells (5 million)Cpr: Sample protein concentration (mg/mL); Aladdin's BCA Protein Quantification Kit (B665595) or Ready-to-Use BCA Protein Quantification Kit (R1491648) is recommended.PrecautionsIt is strongly recommended to first perform a preliminary test using 1-3 samples with expected significant differences (e.g., different types or groups) to familiarize yourself with the procedure. Based on the preliminary results, determine or adjust sample concentrations to prevent unnecessary waste of samples or reagents... Read More | Product content:M665754Component25 TStorageM665754ATris-HCl, 1 mM, PH 8.01 mL-20℃. Avoid freeze/thaw cycleM665754BE. coli Poly(A) Polymerase, 5 U/µL15 µL-20℃. Avoid freeze/thaw cycleM665754C10×Poly(A) Polymerase Buffer80 µL-20℃. Avoid freeze/thaw Product content:M665754Component25 TStorageM665754ATris-HCl, 1 mM, PH 8.01 mL-20℃. Avoid freeze/thaw cycleM665754BE. coli Poly(A) Polymerase, 5 U/µL15 µL-20℃. Avoid freeze/thaw cycleM665754C10×Poly(A) Polymerase Buffer80 µL-20℃. Avoid freeze/thaw cycleM665754DATP, 10 mM15 µL-20℃. Avoid freeze/thaw cycleM665754ERT Primer, 25 µM90 µL-20℃. Avoid freeze/thaw cycleM665754F5×SuperRT Buffer120 µL-20℃. Avoid freeze/thaw cycleM665754GUltraPure dNTP Mix, 10 mM each30 µL-20℃. Avoid freeze/thaw cycleM665754HSuperRT, 200 U/µL15 µL-20℃. Avoid freeze/thaw cycleM665754IRNase-Free Water1 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kit uses the method of adding a poly (A) tail at the 3 'end of miRNA to give miRNA a Poly (A) tail, followed by reverse transcription using Oligo (dT) - Universal tag universal reverse transcription primers to synthesize the first stranded cDNA corresponding to miRNA. The miRNA cDNA first strand synthesis kit contains all the reagents required for the miRNA 3 'end Poly (A) tail modification process and the reverse transcription process after modification. This kit has a very high Poly (A) modification and reverse transcription efficiency, which can range from 1 ng-2 µ The first strand of cDNA corresponding to miRNA was effectively obtained from the total RNA of g. And the operation is simple and fast, which can be used to simultaneously detect multiple miRNAs from a synthesized cDNA reaction. This not only reduces errors and saves samples, but also achieves high-throughput detection.Note: This kit must be used in conjunction with the miRNA fluorescence quantitative detection kit.Self prepared experimental materials: 1 ng-2 µ Total RNA of g, or 0.1 ng-1 µ Small molecule RNA of g.Notes:To prevent RNase pollution, attention should be paid to the following aspects:1. Use plastic products and gun heads without RNase to avoid cross contamination.2. Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use. Plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3. The solution should be prepared using water without RNase.4. Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.Usage:A. The process of miRNA adding Poly (A) tail:1.based on the amount of RNA used, dilute the total RNA of 10 mM ATP with 1 mM Tris (pH 8.0) according to the following formula: ATP dilution coefficient=5000/__ ngExample: If the initial amount of total RNA is 100 ng, then the ATP dilution coefficient is 5000/100=50. About to dilute ATP 50 times (1 µ 10 mM ATP plus 49 for l µ 1 mM Tris at pH 8.0.2. Add the following reagents to the pre cooled RNase free reaction tube in the ice bath to a total volume of 25 µ L. reagent 25 µlReaction system final concentration total RNA* X µl Up to 2 µg 10×Poly(A) Polymerase Buffer 2.5 µl 1× Diluted ATP in step "1" 1 µl / E. coli Poly(A) Polymerase, 5U/µl 0.5 µl 2.5 U RNase-Free Water up to 25 µl /*The total RNA used in the reaction must contain small molecule RNA.This process can also directly use small molecule RNA (recommended dosage of 2-5) µ L. Please determine the amount added based on the abundance of the target miRNA.3. Gently mix the above reaction solution and briefly centrifuge to collect the liquid at the bottom of the tube. Incubate at 37 ℃ for 15 minutes. After this process is completed, immediately proceed with the synthesis of the first strand cDNA or temporarily store it at -20 ℃. If long-term storage is required, it is recommended to store at -80 ℃.B. The process of synthesizing the first strand of modified miRNA cDNA:1. Add the reagents in the table below to the pre cooled RNase free reaction tube in the ice bath until the final volume reaches 20µl: reagent 20 µlReaction system The above Poly (A) reaction solution 4 µl UltraPure dNTP Mix ，10 mM each 1 µl RT Primer ，25 µM 3 µl 5×SuperRT Buffer 4 µl SuperRT ，200 U/µl 0.5 µl RNase-Free Water 7.5 µl2. Gently mix the above reaction solution and briefly centrifuge to collect the liquid at the bottom of the tube. Incubate at 42 ℃ for 50 minutes.3.85 ℃ for 5 minutes and terminate the reaction. The synthesized cDNA reaction solution can be directly used for fluorescence quantitative detection experiments or stored at -20 ℃ for future use... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This reagent kit uses highly sensitive silver dye, which can be applied to protein staining of denatured and non denatured gels. It has the advantages of clear target bands, low background, and flexible control of operation time. In addition, this reagent kit has added a short-term sensitization This reagent kit uses highly sensitive silver dye, which can be applied to protein staining of denatured and non denatured gels. It has the advantages of clear target bands, low background, and flexible control of operation time. In addition, this reagent kit has added a short-term sensitization step, which can significantly reduce the background and enhance the brightness of the target band. P665901Component20 TStorageP665901ASilver Stain Sensitizer (500×)2×1 mLRTP665901BSilver Stain Enhancer3 mLRTP665901CSilver Stain2×250 mLRTP665901DSilver Stain Developer4×125 mLRT Matters needing attention1. Please prepare 50 ml of fixed solution (ultrapure water: ethanol: acetic acid=6:3:1), 50 ml of eluent (10% ethanol), and 50 ml of termination solution (5% acetic acid) in advance.2. Please use deionized water and clean glass or plastic containers during operation, and wear disposable gloves for operation.The entire silver dyeing process needs to be carried out on a shaker, with a rotation speed of about 60 rpm.4. Self prepared ethanol and glacial acetic acid are required.Instructions for useThe dosage of each solution in the following operation steps takes the gel with a size of 8.5 × 5.5 cm and a thickness of 1.0 mm as an example. The gel is immersed in the solution completely, and is operated on a shaker, with a general dosage of 25 ml. For large gel, the dosage of each solution should be scaled up according to the gel volume. Please prepare 50 ml of fixed solution (ultrapure water: ethanol: glacial acetic acid=6:3:1), 50 ml of eluent (10% ethanol), and 50 ml of termination solution (5% glacial acetic acid) in advance.1. Water washing: After electrophoresis is completed, wash the gel twice with ultrapure water for 5 minutes each time.2. Fixation: Fix the gel twice with 25 ml of fixative solution for 15 minutes each time.3. Elution: Wash the adhesive twice with eluent, each time for 5 minutes.4. Water washing: Wash the glue twice with ultrapure water, each time for 5 minutes.5. Sensitization: put the gel washed in the previous step into the silver dye sensitization working solution, incubate it accurately for 1 minute at room temperature, and then wash it with ultrapure water for three times, each time for 20 seconds. Preparation of silver staining sensitization working solution: Take 50 µ l Silver Stain Sensitivity (500 x) and add it to 25 ml of ultrapure water, mix well.6. Silver staining: discard ultrapure water and incubate gel in silver staining working solution for 30 minutes. Preparation of silver staining working solution: Take 25ml Silver Stain and add 50 µ l Silver Stain Enhanced to mix well.7. Water washing: Quickly wash the glue twice with ultrapure water, with each washing accurately controlled for 20 seconds.8. Development: Immerse the washed gel in the developer immediately and incubate it at room temperature for 2-3 minutes until the protein strip is clear. Preparation of developer: Take 25ml Silver Stain Developer and add 30 µ l Silver Stain Enhanced to mix well. Attention: Within 30 seconds of development, protein bands begin to appear and continue to develop for 2-3 minutes. If the protein band appears lighter, the development time can be appropriately extended to 5 minutes or more.9. Termination: After washing the developer on the gel with the termination solution, soak the gel in a new termination solution to react for 10 minutes.Experimental imagesSilver staining results of BSA protein samples after 10% SDS-PAGE gel electrophoresisThe molecular weight of BSA protein is about 66 kD, and the loading amounts from left to right are 50 ng, 10 ng, and 5 ng, respectively... Read More | R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL RT R669988G RNase-Free Water 10 mL RT R669988H Spin Columns FL with Collection Tubes 50 sets RT R669988I Spin Columns RM with Collection Tubes 50 sets RT R669988J RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RTProductsThis kit is used for the extraction and purification of high-quality total RNA from a variety of plants, and is also suitable for the extraction of fungal mycelial RNA. The unique separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while the silicon matrix membrane is used to adsorb the RNA for purification, so that various contaminants, such as polysaccharides, are effectively removed by washing, and the eluted RNA can be directly used in various downstream experiments. The molecular weight of RNA extracted by this kit is more than 200 bases, with high purity and almost no DNA residue. For RNA experiments that are very sensitive to trace DNA, the residual DNA can be removed by digestion on a column using RNase-free DNase. The extracted RNA can be used in Northern Blot, Dot Blot, RT-PCR and in vitro translation experiments.Self-contained reagents: β-mercaptoethanol, anhydrous ethanol (freshly opened or for RNA extraction).Pre-experiment Preparation and Important Notes1. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.2) RNase-free water should be used to prepare the solution.(3) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.2. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.(2) Glassware should be dry-roasted at 180°C for 4 hours before use, and plasticware can be soaked in 0.5M NaOH for 10 minutes, rinsed thoroughly with water and autoclaved.3) RNase-free water should be used to prepare the solution.(4) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.3. Avoid repeated freezing and thawing of the extracted samples, otherwise it will affect the amount and quality of RNA extraction.4. Please add β-mercaptoethanol to Buffer RL before use, add 10µl of β-mercaptoethanol to 1ml of Buffer RL, it can be stored for 1 month at room temperature. Buffer RL with β-mercaptoethanol can be stored at room temperature for 1 month. β-mercaptoethanol is not required for use of Buffer RLC.5. Anhydrous ethanol should be added to Buffer RW2 before first use according to the instructions on the reagent bottle label.6. If precipitation occurs in Buffer RL and Buffer RLC, heat to dissolve and leave at room temperature.7. All centrifugation steps are carried out at room temperature and all steps are performed quickly. Procedure1. 50-100 mg of plant tissue is quickly ground to a powder in liquid nitrogen and added to 600 µl of Buffer RL (check for addition of β-mercaptoethanol before use) or Buffer RLC. vortexing and oscillating to allow for adequate lysis.Note: 1) The main component of Buffer RL is guanidine isothiocyanate, which is suitable for lysis of most plant tissues. However, in some plant tissues (e.g. endosperm of corn), due to the special secondary metabolites, guanidine isothiocyanate causes precipitation of the sample, resulting in poor RNA extraction, in this case, Buffer RLC can be added instead of Buffer RL.2) Incubation at 56°C for 1-3 minutes helps tissue lysis, but do not incubate at high temperatures for plants with high starch content.2. Transfer all the liquid obtained in step 1 to an adsorption column (Spin Columns FL) that has been loaded into a collection tube, centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, and transfer the supernatant from the collection tube to a new centrifuge tube (supplied).Note: 1) The tip of the tip of the gun can be cut off when aspirating liquids to facilitate sampling.2) Spin Columns FL removes most of the debris, but a small portion will still flow out and a precipitate will form in the collection tube after centrifugation, so be careful to avoid aspirating the precipitate when proceeding to the next step.3. Add 0.5 times the volume of anhydrous ethanol to the clean lysate obtained in step 2 and mix rapidly.Note: Precipitation may occur upon addition of ethanol, but does not affect subsequent tests.4. Transfer the solution obtained in the previous step to the Spin Columns RM in the collection tube. If it is not possible to add all of the solution to the column at one time, centrifuge the column at 12,000 rpm for 15 seconds in two batches, discard the waste solution and put the column back into the collection tube.5. Add 350 µl Buffer RW1 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid and put the adsorbent column back into the collection tube.6. Preparation of DNase I mixture: Take 52µl of RNase-Free Water, add 8µl of 10×Reaction Buffer and 20µl of DNase I (1U/µl) to it, mix well, and make a final volume of 80µl of reaction solution.7. Add 80µl of DNase I mixture directly to the adsorption column and incubate at 20-30°C for 15 minutes.8. Add 350 µl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid and put the column back into the collection tube.9. Add 500 µl of Buffer RW2 to the column (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 15 seconds, and discard the waste solution.10. Repeat step 9.11. Place the adsorbent column back into the collection tube, centrifuge at 12,000 rpm for 1 minute, and allow the column to come to room temperature for a few minutes to thoroughly dry out the anhydrous ethanol in the adsorbent column.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (zymography, PCR, etc.).12. Load the adsorption column into a new centrifuge tube, add 30-50 µl of RNase-Free Water to the middle of the adsorbent membrane, leave it at room temperature for 1 minute, centrifuge at 12,000 rpm for 1 minute, and store the resulting RNA solution at -70°C to prevent degradation.Note: 1) The volume of RNase-Free Water should not be less than 30 µl, too small volume affects the recovery rate.2) If you want to increase the RNA yield, repeat step 12 with 30-50 µl of fresh RNase-Free Water.3) If the RNA concentration is to be increased, the resulting solution can be reintroduced into the adsorption column and step 12 repeated... Read More |