| Description | Low-Density Lipoprotein (LDL) in plasma is the main carrier of endogenous cholesterol. It is degraded and metabolized by binding to the LDL receptor (LDL-R) on cell membranes and serves as the primary vehicle for transporting cholesterol to peripheral tissues. However, when LDL, especially oxidized Low-Density Lipoprotein (LDL) in plasma is the main carrier of endogenous cholesterol. It is degraded and metabolized by binding to the LDL receptor (LDL-R) on cell membranes and serves as the primary vehicle for transporting cholesterol to peripheral tissues. However, when LDL, especially oxidized LDL (OX-LDL), is present in excess, the cholesterol it carries accumulates in the arterial walls, increasing the risk of atherosclerosis. Atherosclerosis is the pathological basis and risk factor for the majority of cardiovascular and cerebrovascular diseases.Detection Principle: In a cholesterol assay system containing cholesterol esterase (CHER) and cholesterol oxidase (CHOD), specific surfactants are added to selectively solubilize LDL-C for the determination of LDL-cholesterol. Other lipoproteins (HDL, VLDL, chylomicrons) do not react due to inhibition by the surfactants and sugar compounds, remaining in the form of lipoproteins in the reaction mixture. Based on this principle, LDL-cholesterol can be measured directly. Subsequently, esterase catalyzes the hydrolysis of cholesterol esters to generate Free Cholesterol (FC). FC is oxidized by cholesterol oxidase to produce 4-cholestenone and hydrogen peroxide. Hydrogen peroxide then reacts with 4-aminoantipyrine and other components to produce a red quinoneimine compound, which has a characteristic absorption peak at 546 nm. The LDL-C content is determined by measuring the absorbance at 546 nm.Component96TStorageReagent 118 mL2-8℃. Store in the dark.Reagent 26 mL2-8℃. Store in the dark.Standard1EA2-8℃. Store in the dark.Standard (Powder, 1 vial) Preparation:1. Before use, centrifuge at 8000 g, 4°C for 2 minutes to collect the powder at the bottom of the tube.2. Add 0.1 mL of distilled water to dissolve. Use within one week. The prepared concentration is as indicated on the label.User-Prepared Instruments and Reagents:Mortar (Homogenizer), balance, ice box (ice maker), benchtop centrifuge, adjustable micropipettes, water bath (oven, incubator, metal bath), 96-well plate, centrifuge tubes, microplate reader, distilled water (deionized water or ultrapure water are acceptable), ethanol.Experimental ProcedureIt is recommended to first perform a preliminary test using 1-3 samples with expected significant differences (e.g., different types or groups) to familiarize yourself with the procedure and to determine or adjust sample concentrations based on the preliminary results, preventing unnecessary waste of samples or reagents.1. Sample Extraction1.1 Tissue SamplesWeigh approximately 0.1 g of tissue sample and place it in a mortar. Add 1 mL of ethanol and homogenize in an ice bath. Centrifuge at 12,000 rpm, 4°C or room temperature for 10 minutes. Collect the supernatant for assay.Note: If increasing the sample amount, maintain a tissue mass (g) to ethanol volume (mL) ratio between 1:5 and 1:10.1.2 Liquid SamplesAssay clear liquid samples directly. If turbid, centrifuge and use the supernatant for assay.1.3 Bacterial/Cell SamplesCollect bacteria or cells into a centrifuge tube, centrifuge, and discard the supernatant. Add 1 mL of ethanol per approximately 5 million bacteria/cells. Disrupt the bacteria or cells by sonication in an ice bath (power 200W, pulse 3s on, 10s off, repeat 30 times). Centrifuge at 12,000 rpm, 4°C for 10 minutes. Collect the supernatant and keep it on ice for assay.*Note: If increasing the sample amount, maintain a bacteria/cell count (10⁴) to ethanol volume (mL) ratio between 500:1 and 1000:1.*2. Assay Steps2.1 Preheat the microplate reader for 30 minutes (or wait for the instrument to complete its self-check). Set the wavelength to 546 nm.2.2 Thaw all reagents to room temperature (25°C). Add reagents sequentially to a 96-well plate as follows:Reagent (µL)Test TubeStandard Tube (once)Blank Tube (once)Sample2.5Standard2.5Distilled Water2.5Reagent 1180180180Mix well and incubate at 37°C for 5 minutes. Read the absorbance at 546 nm for each tube (A1 ).Reagent 2606060Mix well and incubate at 37°C for 10 minutes. Read the absorbance at 546 nm for each tube (A2 ). Calculate ΔA = A2 - A1 for each tube.Note:(1) If the A2 value for the Test Tube is greater than 1, dilute the sample with ethanol. The dilution factor (D) must be substituted into the calculation formula.(2) If ΔA for the Test Tube is lower than ΔA for the Blank Tube, consider increasing the sample volume V1 (e.g., increase the sample volume in the Test Tube and the water volume in the Blank Tube to 5 µL or more, keeping Reagents 1 and 2 volumes unchanged; for the Standard Tube, keep at 2.5 µL and add 2.5 µL distilled water to make up volume) or increasing the sample weight W (e.g., to 0.2 g or more). The changed V1 or W must then be substituted into the calculation formula.3. Calculation of Results3.1 Based on Sample MassDerived Formula:LDL-C (µmol/g weight) = (CStandard × V2 ) × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) ÷ (W × V1 ÷ V) × DSimplified Formula:LDL-C (µmol/g weight) = CStandard × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) ÷ W × D3.2 Based on Protein ContentDerived Formula:LDL-C (µmol/mg prot) = (CStandard × V2 ) × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) ÷ (Cpr × V1 ÷ V) × DSimplified Formula:LDL-C (µmol/mg prot) = CStandard × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) ÷ Cpr × D3.3 LDL-C Content in LiquidsDerived Formula:LDL-C (mmol/L) = (CStandard × V2 ) × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) ÷ V1 × DSimplified Formula:LDL-C (mmol/L) = CStandard × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) × D3.4 Based on Cell CountDerived Formula:LDL-C (nmol/10⁴ cells) = (CStandard × V2 ) × 10³ × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) ÷ (500 × V1 ÷ V) × DSimplified Formula:LDL-C (nmol/10⁴ cells) = 2 × CStandard × (ΔATest - ΔABlank ) ÷ (ΔAStandard - ΔABlank ) × DParameter Definitions:CStandard : Concentration as indicated on the label (mmol/L or µmol/mL)V1 : Volume of sample added (0.0025 mL)V: Volume of extraction buffer (ethanol) added (1 mL)V2 : Volume of standard added (0.0025 mL)D: Dilution factor (1 if not diluted)500: Number of cells (in units of 10⁴)W: Sample weight (g)Cpr: Protein concentration of the supernatant (mg/mL); Aladdin's BCA Protein Quantification Kit (B665595) or Ready-to-Use BCA Protein Quantification Kit (R1491648) is recommended.Precautions1. It is recommended to first perform a preliminary test using 1-3 samples with expected significant differences (e.g., different types or groups) to familiarize yourself with the procedure. Based on the preliminary results, determine or adjust sample concentrations to prevent unnecessary waste of samples or reagents.2. This product is for research use only. Not for use in clinical diagnosis. For your safety and health, please wear a lab coat and disposable gloves during operation... Read More | The aladdin 488 Caspase-3 live cell assay kit contains the aladdin 488 Caspase-3 substrate and the Ac-DEVD-CHO Caspase-3 inhibitor. aladdin 488 Caspase-3 Substrate provides an effective tool for detecting apoptosis based on Caspase-3 activity, suitable for fluorescence microscopy and flow cytometry.The aladdin 488 Caspase-3 live cell assay kit contains the aladdin 488 Caspase-3 substrate and the Ac-DEVD-CHO Caspase-3 inhibitor. aladdin 488 Caspase-3 Substrate provides an effective tool for detecting apoptosis based on Caspase-3 activity, suitable for fluorescence microscopy and flow cytometry. Compared with other fluorescent substrates or fluorescent inhibitors of Caspase based on ( FLICA ) analysis, aladdin 488 Caspase-3 Substrate does not inhibit the apoptosis process of intact cells while detecting Caspase-3 activity. Substrate is composed of fluorescent DNA dyes coupled with Caspase-3 DEVD recognition sequence. Substrate initially had no fluorescence and entered the cytoplasm through the cell membrane. In apoptotic cells, Caspase-3 cleaves the Substrate and releases high-affinity DNA staining, which migrates to the nucleus to label DNA and emits bright green fluorescence.Therefore, aladdin 488 Caspase-3 Substrate is bifunctional, which can not only detect Caspase-3 activity, but also visualize the morphological changes of the nucleus during apoptosis. Aladdin 488 staining can be fixed in formaldehyde and compatible with subsequent immunostaining experiments.Parameters:aladdin 488：Ex/Em = 500/530 nm (with DNA)Component：Points for attention：1.Please instantaneously centrifuge the product to the bottom of the tube before use, and then carry out subsequent experiments. 2.Cells can be co-stained with a final concentration of 1µM Hoechst 33342 dye to produce blue fluorescence staining of the nucleus ( Ex / Em = 346 / 460 nm ). 3.Aladdin 488 staining can be fixed by formaldehyde, but it is not compatible with methanol fixation. 4.Formaldehyde-fixed aladdin 488-stained cells can be treated with 0.1 % TritonX-100 for subsequent staining, but the brightness of the treated staining may be weakened. 5.Fluorescent dyes all have quenching problems, please try to avoid light to slow down the fluorescence quenching. 6.For your safety and health, please wear experimental clothes and wear disposable gloves.Scope of application：Caspase 3 kit and apoptosis detectionUsage:1. Experimental optimization: The experimental steps provided below are based on the endpoint detection system. Aladdin 488 Substrate can also be used for long-term cell incubation course research. Cell density, substrate concentration, and inhibitor concentration may need to be optimized. The optimal substrate concentration may be between 1-10 µ Between M. Cells can be incubated with substrates in culture medium, PBS, or other buffer of your choice. For adherent cells, we recommend replacing them with fresh culture media containing substrates to prevent background heterogeneity. The operation of changing the medium or washing the cells after substrate incubation is freely selectable.2. We suggest that you set the following controls:A. Negative control: cells that do not induce apoptosis;B. Positive control: cells that induce apoptosis;C. Inhibitor control: Induce cell apoptosis while incubating Caspase-3/7 inhibitors (or 10-30 minutes in advance), and finally add Aladdin 488 Caspase-3 substrate.3. The Caspase-3/7 inhibitor Ac-DEVD-CHO in the Ac-DEVD-CHO Caspase-3 inhibitor control kit can be used to confirm that Caspase-3/7 depends on the fluorescence signal of aladdin 488. For inhibitor control, the final concentration of the inhibitor should be at least twice the substrate concentration (e.g. when using 5 µ At substrate M aladdin 488, the concentration of Ac-DEVD-CHO is 10 µ M). Before adding the substrate, incubate Ac-DEVD-CHO at room temperature for 15-30 minutes. After adding the substrate, continue to retain the inhibitor in the incubation solution. Ac-DEVD-CHO is a reversible competitive inhibitor. In certain cell types, effective Caspase-3/7 inhibitors require the use of irreversible inhibitors, such as Z-DEVD-FMK, or the addition of inhibitors before or during apoptosis induction.4. Flow cytometry(1) Choose appropriate methods to induce cell apoptosis, with untreated cell samples as controls.(2) Adhering cells should be digested with trypsin or other methods before performing the aladdin 488 Caspase-3 experiment.(3) Resuspend cells with culture medium or buffer to achieve a cell density of 106 cells/mL(4) Suck 0.2 mL of cell suspension into a flow cytometry test tube.(5) Inhibitor control samples were treated with Ac-DEVD-CHO on cells (see 3 above) Ac-DEVD-CHO Caspase-3 inhibitor control.(6) 200 µ Add 5 to L cell suspension µ Substrate of 0.2 mM and immediately mix to achieve a substrate concentration of 5 µ M. The optimal substrate concentration for different cells may vary and requires analysis and optimization.(7) Incubate cells at room temperature in dark for 15-30 minutes.(8) Join 300 µ L-medium or PBS, analyzed by flow cytometry. Detect the channel for green fluorescence (Ex/Em=485/515 nm).5. Fluorescence microscope(1) Choose appropriate methods to induce cell apoptosis, with untreated cell samples as controls.(2) Inhibitor control samples were treated with Ac-DEVD-CHO on cells (see 3 above) Ac-DEVD-CHO Caspase-3 inhibitor control.(3) Using a solution containing 5 µ M Substrate's fresh culture medium or PBS is used to replace the cell culture medium (see 1 above) Experimental optimization). For the inhibitor control group, the inhibitor was incubated together with the substrate.(4) Incubate cells at room temperature for 30 minutes or longer.(5) Cells can be directly observed in culture media containing Substrate. For the endpoint analysis method, PBS was used to clean the cells, fluorescence microscopy was used to observe the cells, and a filter (Ex/Em=485/515 nm) was used to observe green fluorescence.6. Fluorescence enzyme-linked immunosorbent assay (ELISA) reader(1) Adherent cells grow in black 96 well plates; Suspend cells, adjust the density to 106 cells/mL, and divide 0.2 mL of cell suspension into one well.(2) Choose appropriate methods to induce cell apoptosis, with untreated cell samples as controls. Note: Cells may be processed in tubes or bottles and then transferred to a 96 well detection plate.(3) Inhibitor control samples were treated with Ac-DEVD-CHO on cells (see 3 above) Ac-DEVD-CHO Caspase-3 inhibitor control.(4) For suspended cells, directly add Substrate and mix well. For adherent cells, use a solution containing 5 µ M Substrate's fresh culture medium or PBS is used to replace the cell culture medium (see 1 above) Experimental optimization). For the inhibitor control group, the inhibitor was incubated together with the substrate.(5) Cells can be directly observed in culture media containing Substrate.(6) For suspended cells, gently shake to resuspend the cells. The fluorescence enzyme-linked immunosorbent assay instrument is set with an excitation wavelength of 488 nm and an emission wavelength of 520 nm. Suggest using bottom collection method for adherent cells. Changes in the density of adherent cells may lead to inaccurate readings... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665993Component240 TStorageN665993AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665993BIndex N925-N948 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle. Products Introduction This kit is a companion kit to the transposase-Products contentN665993Component240 TStorageN665993AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665993BIndex N925-N948 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle. Products Introduction This kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. ProcedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol.Index N501 Primer for IlluminaIndex N901-N996 Primer for Illumina... Read More | R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL RT R669988G RNase-Free Water 10 mL RT R669988H Spin Columns FL with Collection Tubes 50 sets RT R669988I Spin Columns RM with Collection Tubes 50 sets RT R669988J RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RTProductsThis kit is used for the extraction and purification of high-quality total RNA from a variety of plants, and is also suitable for the extraction of fungal mycelial RNA. The unique separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while the silicon matrix membrane is used to adsorb the RNA for purification, so that various contaminants, such as polysaccharides, are effectively removed by washing, and the eluted RNA can be directly used in various downstream experiments. The molecular weight of RNA extracted by this kit is more than 200 bases, with high purity and almost no DNA residue. For RNA experiments that are very sensitive to trace DNA, the residual DNA can be removed by digestion on a column using RNase-free DNase. The extracted RNA can be used in Northern Blot, Dot Blot, RT-PCR and in vitro translation experiments.Self-contained reagents: β-mercaptoethanol, anhydrous ethanol (freshly opened or for RNA extraction).Pre-experiment Preparation and Important Notes1. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.2) RNase-free water should be used to prepare the solution.(3) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.2. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.(2) Glassware should be dry-roasted at 180°C for 4 hours before use, and plasticware can be soaked in 0.5M NaOH for 10 minutes, rinsed thoroughly with water and autoclaved.3) RNase-free water should be used to prepare the solution.(4) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.3. Avoid repeated freezing and thawing of the extracted samples, otherwise it will affect the amount and quality of RNA extraction.4. Please add β-mercaptoethanol to Buffer RL before use, add 10µl of β-mercaptoethanol to 1ml of Buffer RL, it can be stored for 1 month at room temperature. Buffer RL with β-mercaptoethanol can be stored at room temperature for 1 month. β-mercaptoethanol is not required for use of Buffer RLC.5. Anhydrous ethanol should be added to Buffer RW2 before first use according to the instructions on the reagent bottle label.6. If precipitation occurs in Buffer RL and Buffer RLC, heat to dissolve and leave at room temperature.7. All centrifugation steps are carried out at room temperature and all steps are performed quickly. Procedure1. 50-100 mg of plant tissue is quickly ground to a powder in liquid nitrogen and added to 600 µl of Buffer RL (check for addition of β-mercaptoethanol before use) or Buffer RLC. vortexing and oscillating to allow for adequate lysis.Note: 1) The main component of Buffer RL is guanidine isothiocyanate, which is suitable for lysis of most plant tissues. However, in some plant tissues (e.g. endosperm of corn), due to the special secondary metabolites, guanidine isothiocyanate causes precipitation of the sample, resulting in poor RNA extraction, in this case, Buffer RLC can be added instead of Buffer RL.2) Incubation at 56°C for 1-3 minutes helps tissue lysis, but do not incubate at high temperatures for plants with high starch content.2. Transfer all the liquid obtained in step 1 to an adsorption column (Spin Columns FL) that has been loaded into a collection tube, centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, and transfer the supernatant from the collection tube to a new centrifuge tube (supplied).Note: 1) The tip of the tip of the gun can be cut off when aspirating liquids to facilitate sampling.2) Spin Columns FL removes most of the debris, but a small portion will still flow out and a precipitate will form in the collection tube after centrifugation, so be careful to avoid aspirating the precipitate when proceeding to the next step.3. Add 0.5 times the volume of anhydrous ethanol to the clean lysate obtained in step 2 and mix rapidly.Note: Precipitation may occur upon addition of ethanol, but does not affect subsequent tests.4. Transfer the solution obtained in the previous step to the Spin Columns RM in the collection tube. If it is not possible to add all of the solution to the column at one time, centrifuge the column at 12,000 rpm for 15 seconds in two batches, discard the waste solution and put the column back into the collection tube.5. Add 350 µl Buffer RW1 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid and put the adsorbent column back into the collection tube.6. Preparation of DNase I mixture: Take 52µl of RNase-Free Water, add 8µl of 10×Reaction Buffer and 20µl of DNase I (1U/µl) to it, mix well, and make a final volume of 80µl of reaction solution.7. Add 80µl of DNase I mixture directly to the adsorption column and incubate at 20-30°C for 15 minutes.8. Add 350 µl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid and put the column back into the collection tube.9. Add 500 µl of Buffer RW2 to the column (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 15 seconds, and discard the waste solution.10. Repeat step 9.11. Place the adsorbent column back into the collection tube, centrifuge at 12,000 rpm for 1 minute, and allow the column to come to room temperature for a few minutes to thoroughly dry out the anhydrous ethanol in the adsorbent column.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (zymography, PCR, etc.).12. Load the adsorption column into a new centrifuge tube, add 30-50 µl of RNase-Free Water to the middle of the adsorbent membrane, leave it at room temperature for 1 minute, centrifuge at 12,000 rpm for 1 minute, and store the resulting RNA solution at -70°C to prevent degradation.Note: 1) The volume of RNase-Free Water should not be less than 30 µl, too small volume affects the recovery rate.2) If you want to increase the RNA yield, repeat step 12 with 30-50 µl of fresh RNase-Free Water.3) If the RNA concentration is to be increased, the resulting solution can be reintroduced into the adsorption column and step 12 repeated... Read More |