| Description | Triglycerides (TG), also known as triacylglycerols, are fat molecules formed from three long-chain fatty acids and glycerol. They are the most abundant lipids in the human body. Most tissues can utilize the breakdown products of triglycerides for energy. Simultaneously, tissues like the liver and Triglycerides (TG), also known as triacylglycerols, are fat molecules formed from three long-chain fatty acids and glycerol. They are the most abundant lipids in the human body. Most tissues can utilize the breakdown products of triglycerides for energy. Simultaneously, tissues like the liver and adipose tissue can synthesize triglycerides. The enzymatic method for measuring TG is commonly used in biochemical assays due to its characteristics: 1. High sensitivity, accuracy, and precision; 2. Use of mild reaction conditions; 3. Simple operation; 4. Suitable for semi-automatic biochemical analyzers.Detection Principle: Triglycerides are hydrolyzed by lipoprotein lipase (LPL) into glycerol and free fatty acids. Glycerol is then phosphorylated by glycerol kinase (GK) and adenosine triphosphate (ATP) to form glycerol-3-phosphate (G-3-P). G-3-P is subsequently oxidized by glycerol-3-phosphate oxidase (GPO), producing hydrogen peroxide. The hydrogen peroxide, in the presence of peroxidase (POD), 4-aminoantipyrine (4-AAP), and phenol (collectively known as PAP), reacts to form a red-colored quinoneimine dye (Trinder reaction). The quinoneimine dye has a maximum absorption at 510 nm. The absorbance is directly proportional to the triglyceride concentration in the sample and can be measured using a microplate reader between 500-520 nm.This kit is used for the quantitative determination of triglyceride content in serum, cells, tissues, and other samples from humans or animals. This kit is intended for research use only and is not suitable for clinical diagnosis or other purposes.Component100TStorageBuffer Solution24 mL2-8℃. Store in the dark.Enzyme Reagent6 mL2-8℃. Store in the dark.Glycerol Standard (1.7 mmol/L)1 mL2-8℃User-Prepared Instruments and ReagentsddH₂O, Physiological Saline or PBSCentrifuge tubes or small test tubes, Water bath or incubatorMicroplate reader, 96-well plate, Semi-automatic biochemical analyzerExperimental Procedure1. Sample Preparation1.1 Serum, Plasma, Cerebrospinal Fluid SamplesSerum or plasma separated from the test sample should not be hemolyzed. Assay directly. If the concentration exceeds the linear range, dilute with physiological saline before assaying.1.2 Cell Samples(1) Take an appropriate amount of cells (generally recommended >10⁶), centrifuge at 1000 g for 10 min, discard the supernatant, keep the pellet.(2) Wash the pellet 1-2 times with PBS or physiological saline, centrifuge at 1000 g for 10 min, discard the supernatant, keep the pellet.(3) Add 200-300 µL of PBS or physiological saline to homogenize. Sonicate the cells on ice (power 300W, pulse 3-5s, interval 30s, repeat 3-5 times). Alternatively, homogenize manually. Do not centrifuge the prepared homogenate. Alternatively, lyse with 1-2% Triton X-100 on ice for 30-60 min. Do not centrifuge the prepared lysate.1.3 Tissue SamplesAccurately weigh an appropriate amount of tissue sample. Add physiological saline or PBS at a mass (g) to volume (mL) ratio of 1:9. Homogenize manually or mechanically on ice. Centrifuge at 2500-3000 g for 10 min. Collect the supernatant for assay.2. Preparation of GPO-PAP Working SolutionBefore use, mix the Buffer Solution and Enzyme Reagent at a 4:1 volume ratio. Mix well. Store at 4°C.3. TG Assay Steps using Microplate Reader3.1 Add reagents sequentially to the 96-well plate according to the table below. Mix thoroughly and incubate at 37°C in a water bath or incubator for 10 minutes.Reagent (µL)Blank WellStandard WellTest WellddH2O2.5//Glycerol Standard (1.7 mmol/L)/2.5/Test Sample//2.5GPO-PAP Working Solution2502502503.2 Measure the absorbance between 500-520 nm using the microplate reader. Zero the instrument with the blank well, then read the absorbance of the standard well and all test wells.4. TG Assay Steps using Semi-Automatic Biochemical Analyzer4.1 Instrument Parameter Settings:WavelengthTemperatureDelay TimeMeasurement TimeReagent BlankReaction TypeAspiration Volume510-550nm37℃2s2sYesEndpoint800µL4.2 Add reagents sequentially to tubes according to the table below. Mix thoroughly and incubate at 37°C in a water bath for 10 minutes.Reagent (µL)Blank TubeStandard TubeTest TubeddH2O10//Glycerol Standard (1.7 mmol/L)/10/Test Sample//10GPO-PAP Working Solution1000100010004.3 Zero the instrument with the blank tube, then read the absorbance of the standard tube and all test tubes.5. Calculation Formula5.1 For serum, plasma, and other liquid samples (Blank zeroed):TG (mmol/L) = (Absorbance of Test Well/Tube / Absorbance of Standard Well/Tube) × 1.7 mmol/L5.2 For cell, tissue, and other samples (Blank zeroed):TG (mmol/g prot) = (Absorbance of Test Well/Tube / Absorbance of Standard Well/Tube) × 1.7 mmol/L / Sample Protein Concentration (mg/mL)Reference Interval (Healthy Adults)Desirable range: < 1.7 mmol/L (< 150 mg/dL)Borderline high: 1.7 – 2.25 mmol/L (150 – 199 mg/dL)High: 2.26 – 5.64 mmol/L (200 – 499 mg/dL)Very high: ≥ 5.65 mmol/L (≥ 500 mg/dL)Precautions1. Avoid repeated freeze-thaw cycles for the low-temperature reagents mentioned above to prevent inactivation or decreased efficiency.2. The GPO-PAP Working Solution should be prepared immediately before use and is not suitable for long-term storage at 4°C.3. This method can be directly used to detect TG content in cerebrospinal fluid but cannot directly detect TG in urine, as untreated urine contains reducing substances that interfere with the peroxidase reaction.4. If test samples cannot be assayed immediately, they should be stored at 2-8°C and are stable for 3 days.5. The linear range of this method is up to 9.0 mmol/L. If the sample TG concentration is too high, results may be falsely low. Dilute the sample with physiological saline and re-assay, multiplying the result by the dilution factor.6. The working reagent should be protected from contamination by substances like glucose and cholesterol.7. The reagent is susceptible to oxidation by air, turning red. A blank measurement is necessary.8. For your safety and health, please wear a lab coat and disposable gloves during operation.9.Use the reagents as soon as possible after opening to prevent affecting subsequent experimental results... Read More | Format:2-ComponentEnzyme:Horseradish peroxidase | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | The miRNA extraction kit is specifically designed to isolate and purify miRNAs from various animal tissues, plant tissues, cells, serum, plasma and other samples. It can also extract small molecule RNAs such as siRNA and snRNA that are less than 200 nt, and can also be used for the extraction of The miRNA extraction kit is specifically designed to isolate and purify miRNAs from various animal tissues, plant tissues, cells, serum, plasma and other samples. It can also extract small molecule RNAs such as siRNA and snRNA that are less than 200 nt, and can also be used for the extraction of total RNA. This product combines phenol/guanidine lysis technology and silicon matrix membrane purification technology. The unique lysis solution can effectively inhibit RNases while removing most of DNA and proteins from cell or tissue samples through organic extraction. For some sensitive downstream experiments, if miRNA enrichment is required, this kit can be used to enrich miRNA separately. This product is suitable for a wide range of samples, with high purity of prepared RNA, and can be directly used for sensitive downstream applications, such as Northern Blot analysis, Real Time PCR, Microarray Analysis, etc. M665531Component50 TStorageM665531ATRIzon Reagent60 mL2-8℃. Protect from ligt.M665531BBuffer RWT (concentrate)15 mLRTM665531CBuffer RW2 (concentrate)11 mLRTM665531DRNase-Free Water10 mLRTM665531ESpin Columns RM with Collection Tubes50 setsRTM665531FSpin Columns RS with Collection Tubes50 setsRTM665531GRNase-Free Centrifuge Tubes (1.5 mL)50 EART Self prepared reagents: chloroform, anhydrous ethanol (newly opened or dedicated for RNA extraction).Preparation and important precautions before the experiment:To prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The extracted samples should avoid repeated freeze-thaw cycles, otherwise it will affect the quantity and quality of miRNA extraction.Before the first use, anhydrous ethanol should be added to Buffer RWT and Buffer RW2 according to the instructions on the reagent bottle label.4. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.Operation steps:Protocol A: miRNA enrichment (can be directly used for sensitive downstream experiments)1. Sample processing1a Organization: Grind the organization in liquid nitrogen. Add 1 ml of TRIzon Reagent to every 30-50 mg of tissue, shake and mix well. The sample volume shall not exceed one tenth of the volume of TRIzon Reagent.1b Single layer culture of cells: Remove the culture medium, add TRIzon Reagent, and add 1 ml of TRIzon Reagent every 10 cm2 (the amount of lysis solution depends on the area of the culture bottle).1c Cell suspension: Centrifuge to obtain cell precipitate, discard supernatant. Add 1 ml of TRIzon Reagent to every 5 x 106-1 x 107 cells (cells do not require washing).1d Plasma or serum: Take 200 µ Add 5 times the volume of TRIzon Reagent to plasma or serum samples, shake and mix well for 30 seconds.2. After adding TRIzon Reagent to the sample, blow it repeatedly several times to fully crack it. Leave at room temperature for 5 minutes to completely separate the protein nucleic acid complex.3. Optional steps: Centrifuge at 4 ℃ 12000 rpm (~13400 × g) for 5 minutes, take the supernatant, and transfer it to a new centrifuge tube (provided by oneself) (if the sample contains more proteins, fats, polysaccharides, etc., this step can be performed).4. Add chloroform to the supernatant and add 200 to every 1 ml of TRIzon Reagent used µ Chloroform, cover the tube, vigorously shake for 15 seconds, and let it sit at room temperature for 5 minutes.Centrifuge at 5.4 ℃ and 12000 rpm for 15 minutes. The sample is divided into three layers: red organic phase, middle layer, and colorless aqueous phase. Transfer the upper colorless aqueous phase to a new centrifuge tube (self prepared).6. Add 1/3 volume of anhydrous ethanol to the solution obtained in step 5, mix well, and transfer the obtained solution and precipitate together into the adsorption column RM (Spin Columns RM) that has been loaded into the collection tube. If you cannot add all the solution to the adsorption column at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the adsorption column RM after centrifugation, and retain the effluent.7. Add 2/3 times the volume of anhydrous ethanol to the solution obtained in step 6 and mix well.8. Transfer the solution and precipitate obtained from the previous step into the adsorption column RS (Spin Columns RS) that has been loaded into the collection tube. If you cannot add all the solution to the adsorption column at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.9. Add 700 to the adsorption column RS µ L Buffer RWT (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.10. Add 500 to the adsorption column RS µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.11. Repeat step 10.12. Centrifuge at 12000 rpm for 1 minute and discard the waste liquid from the collection tube. Place the adsorption column RS at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column RS, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).13. Place the adsorption column RS in a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store the obtained RNA solution at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 13 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column RS and repeat step 13Protocol B: Extraction of total RNA (including miRNA and other small molecule RNAs<200 nt), steps 1-5 are the same as protocol A.6. Add 1.25 times the volume of anhydrous ethanol to the solution obtained in step 5 and mix well.7. Transfer the solution and precipitate obtained from the previous step into the spin columns RM that have been loaded into the collection tube. If you cannot add all the solution to the adsorption column RM at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.8. Add 700 to the adsorption column RM µ L Buffer RWT (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.9. Add 500 to the adsorption column RM µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.10. Repeat step 9.11. Centrifuge at 12000 rpm for 1 minute and discard the waste liquid from the collection tube. Place the adsorption column RM at room temperature for a few minutes to thoroughly air dry. Attention: The purpose of this step is to remove residual ethanol from the adsorption column RM, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).12. Transfer the adsorption column RM into a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store the obtained RNA solution at -70 ℃ to prevent degradation. Attention: 1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 12 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column RM and repeat step 12... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |