| Description | Triglycerides (TG), also known as triacylglycerols, are fat molecules formed from three long-chain fatty acids and glycerol. They are the most abundant lipids in the human body. Most tissues can utilize the breakdown products of triglycerides for energy. Simultaneously, tissues like the liver and Triglycerides (TG), also known as triacylglycerols, are fat molecules formed from three long-chain fatty acids and glycerol. They are the most abundant lipids in the human body. Most tissues can utilize the breakdown products of triglycerides for energy. Simultaneously, tissues like the liver and adipose tissue can synthesize triglycerides. The enzymatic method for measuring TG is commonly used in biochemical assays due to its characteristics: 1. High sensitivity, accuracy, and precision; 2. Use of mild reaction conditions; 3. Simple operation; 4. Suitable for semi-automatic biochemical analyzers.Detection Principle: Triglycerides are hydrolyzed by lipoprotein lipase (LPL) into glycerol and free fatty acids. Glycerol is then phosphorylated by glycerol kinase (GK) and adenosine triphosphate (ATP) to form glycerol-3-phosphate (G-3-P). G-3-P is subsequently oxidized by glycerol-3-phosphate oxidase (GPO), producing hydrogen peroxide. The hydrogen peroxide, in the presence of peroxidase (POD), 4-aminoantipyrine (4-AAP), and phenol (collectively known as PAP), reacts to form a red-colored quinoneimine dye (Trinder reaction). The quinoneimine dye has a maximum absorption at 510 nm. The absorbance is directly proportional to the triglyceride concentration in the sample and can be measured using a microplate reader between 500-520 nm.This kit is used for the quantitative determination of triglyceride content in serum, cells, tissues, and other samples from humans or animals. This kit is intended for research use only and is not suitable for clinical diagnosis or other purposes.Component100TStorageBuffer Solution24 mL2-8℃. Store in the dark.Enzyme Reagent6 mL2-8℃. Store in the dark.Glycerol Standard (1.7 mmol/L)1 mL2-8℃User-Prepared Instruments and ReagentsddH₂O, Physiological Saline or PBSCentrifuge tubes or small test tubes, Water bath or incubatorMicroplate reader, 96-well plate, Semi-automatic biochemical analyzerExperimental Procedure1. Sample Preparation1.1 Serum, Plasma, Cerebrospinal Fluid SamplesSerum or plasma separated from the test sample should not be hemolyzed. Assay directly. If the concentration exceeds the linear range, dilute with physiological saline before assaying.1.2 Cell Samples(1) Take an appropriate amount of cells (generally recommended >10⁶), centrifuge at 1000 g for 10 min, discard the supernatant, keep the pellet.(2) Wash the pellet 1-2 times with PBS or physiological saline, centrifuge at 1000 g for 10 min, discard the supernatant, keep the pellet.(3) Add 200-300 µL of PBS or physiological saline to homogenize. Sonicate the cells on ice (power 300W, pulse 3-5s, interval 30s, repeat 3-5 times). Alternatively, homogenize manually. Do not centrifuge the prepared homogenate. Alternatively, lyse with 1-2% Triton X-100 on ice for 30-60 min. Do not centrifuge the prepared lysate.1.3 Tissue SamplesAccurately weigh an appropriate amount of tissue sample. Add physiological saline or PBS at a mass (g) to volume (mL) ratio of 1:9. Homogenize manually or mechanically on ice. Centrifuge at 2500-3000 g for 10 min. Collect the supernatant for assay.2. Preparation of GPO-PAP Working SolutionBefore use, mix the Buffer Solution and Enzyme Reagent at a 4:1 volume ratio. Mix well. Store at 4°C.3. TG Assay Steps using Microplate Reader3.1 Add reagents sequentially to the 96-well plate according to the table below. Mix thoroughly and incubate at 37°C in a water bath or incubator for 10 minutes.Reagent (µL)Blank WellStandard WellTest WellddH2O2.5//Glycerol Standard (1.7 mmol/L)/2.5/Test Sample//2.5GPO-PAP Working Solution2502502503.2 Measure the absorbance between 500-520 nm using the microplate reader. Zero the instrument with the blank well, then read the absorbance of the standard well and all test wells.4. TG Assay Steps using Semi-Automatic Biochemical Analyzer4.1 Instrument Parameter Settings:WavelengthTemperatureDelay TimeMeasurement TimeReagent BlankReaction TypeAspiration Volume510-550nm37℃2s2sYesEndpoint800µL4.2 Add reagents sequentially to tubes according to the table below. Mix thoroughly and incubate at 37°C in a water bath for 10 minutes.Reagent (µL)Blank TubeStandard TubeTest TubeddH2O10//Glycerol Standard (1.7 mmol/L)/10/Test Sample//10GPO-PAP Working Solution1000100010004.3 Zero the instrument with the blank tube, then read the absorbance of the standard tube and all test tubes.5. Calculation Formula5.1 For serum, plasma, and other liquid samples (Blank zeroed):TG (mmol/L) = (Absorbance of Test Well/Tube / Absorbance of Standard Well/Tube) × 1.7 mmol/L5.2 For cell, tissue, and other samples (Blank zeroed):TG (mmol/g prot) = (Absorbance of Test Well/Tube / Absorbance of Standard Well/Tube) × 1.7 mmol/L / Sample Protein Concentration (mg/mL)Reference Interval (Healthy Adults)Desirable range: < 1.7 mmol/L (< 150 mg/dL)Borderline high: 1.7 – 2.25 mmol/L (150 – 199 mg/dL)High: 2.26 – 5.64 mmol/L (200 – 499 mg/dL)Very high: ≥ 5.65 mmol/L (≥ 500 mg/dL)Precautions1. Avoid repeated freeze-thaw cycles for the low-temperature reagents mentioned above to prevent inactivation or decreased efficiency.2. The GPO-PAP Working Solution should be prepared immediately before use and is not suitable for long-term storage at 4°C.3. This method can be directly used to detect TG content in cerebrospinal fluid but cannot directly detect TG in urine, as untreated urine contains reducing substances that interfere with the peroxidase reaction.4. If test samples cannot be assayed immediately, they should be stored at 2-8°C and are stable for 3 days.5. The linear range of this method is up to 9.0 mmol/L. If the sample TG concentration is too high, results may be falsely low. Dilute the sample with physiological saline and re-assay, multiplying the result by the dilution factor.6. The working reagent should be protected from contamination by substances like glucose and cholesterol.7. The reagent is susceptible to oxidation by air, turning red. A blank measurement is necessary.8. For your safety and health, please wear a lab coat and disposable gloves during operation.9.Use the reagents as soon as possible after opening to prevent affecting subsequent experimental results... Read More | Products content Box 1: Circularization reagentC666001Component16 TStorageC666001ASplint Oligo20 µL-20℃.Avoid freeze/thaw cycle. C666001B5×Splint Buffer T4250 µL-20℃.Avoid freeze/thaw cycle. C666001CDNA Ligase50 µL-20℃.Avoid freeze/thaw cycle. C666001DDigestion Products content Box 1: Circularization reagentC666001Component16 TStorageC666001ASplint Oligo20 µL-20℃.Avoid freeze/thaw cycle. C666001B5×Splint Buffer T4250 µL-20℃.Avoid freeze/thaw cycle. C666001CDNA Ligase50 µL-20℃.Avoid freeze/thaw cycle. C666001DDigestion Buffer20 µL-20℃.Avoid freeze/thaw cycle. C666001EDigestion Enzyme I70 µL-20℃.Avoid freeze/thaw cycle. C666001FDigestion Enzyme III25 µL-20℃.Avoid freeze/thaw cycle. Box 2: Magnetic Beads for DNA Purification and RecoveryC666001Component16 TStorageC666001GCMPure4×1.5 mL2-8℃Products IntroductionThe Cyclization Kit is a modular kit tailored for the MGI high-throughput sequencing platform. With this kit, PCR products after junction ligation can be prepared into single-stranded circular DNA libraries suitable for MGI sequencers. All reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 (Cat. No. 12321D) is recommended.2. "Qubit" 3.0 Fluorescence Quantimeter (ThermoFisher, Cat. No. Q33216)3. Qubit" ssDNA Assay Kit (Invitrogen, Cat. No. Q10212)4. Anhydrous ethanol, EB (10 mM Tris-HCl, pH 8.0), NF Water (pH between 7.0 and 8.0).5. reaction tubes: low adsorption PCR tubes with 1.5 mIEP tubes are recommended: 5.Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and libraries. Pre-experiment Preparation and Important Notes 1. Sample preparation.PCR product: 2330 ng total (total amount when multiple PCR products are mixed) in a volume of 49 pL (if the volume of PCR product is insufficient, add NF Water to bring the total volume to 49 pl). -PCR product: Fragment size: The fragment peak is between 200-500 bp. -PCR product fragment size: Fragment peaks between 200-500 bp. -PCR product modification: Fixed sequences (with Index) for MGISEQ-2000, MGISEQ-200 and BGISEQ-500 sequencing platforms were added.2. Reagent preparation-Remove the corresponding reagents from the kit, centrifuge briefly, and place the enzyme mixture on ice until ready to use: buffers need to be dissolved at room temperature before use, then centrifuged with shaking and placed on ice until ready to use, and NF Water and EB are placed at room temperature until ready to use: "Please make up the mixture on ice:Precipitation may appear after the buffer in the kit is dissolved, the precipitation does not affect the function of the reagent, please shake and mix well until the precipitation disappears and then use. Schematic diagram of the cyclization process procedurecyclize 1. 1 wl of Splint Oligo was added to the 49JI PCR product. The product was denatured and incubated on a PCR instrument at 95°C for 3 min, then immediately transferred to an ice bath and allowed to stand for 2 min. 2. The reaction mixture was prepared on ice according to the following system. 3. Add 15ul of the above reaction mixture to 50µl of denatured DNA.4. Place the above PCR tubes on the PCR instrument under the following conditions Reaction. digest 1. Prepare the digestion reaction solution on ice according to the following system. 2. After the cyclization reaction, add 8l of digestion reaction solution directly to the cyclization system, mix well, centrifuge briefly and then place the PCR tube on the PCR instrument and react under the following conditions. 3. Purification was carried out immediately after the reaction.Purification of digestive products1. Remove CMPure at room temperature 30 minutes prior to use and mix well with shaking.2. Transfer the digested product to a 1.5 mIEP tube, pipette 340 pICMPure into the digested product, mix well by gently blowing 10 times with a pipette and incubate for 10 minutes at room temperature.3. Instantaneous centrifugation, place the EP tube on a magnetic rack and let stand for 5 minutes until the liquid is clear, pipette and discard the supernatant.4. Keep the EP tube fixed on a magnetic rack, add 250ul of freshly prepared 80% ethanol, let it stand at room temperature for 1 minute, then carefully discard the supernatant.5. Repeat step 4 once, try to suck up the liquid at the bottom of the tube: Note: Do not suck up the magnetic beads, so as not to affect the yield.6. Keep the EP tube fixed on the magnetic rack, open the cap and dry it at room temperature for 5-10 minutes.7. Remove the EP tube from the magnetic rack, add 35ul of EB or NF Water for DNA elution, pipette blow to mix and dissolve at room temperature for 10 min.8. Centrifuge instantaneously, place the EP tube on a magnetic rack and let stand for 2 minutes until the liquid is clarified, transfer the supernatant to a new EP tube. -Store at 20C and leave to prepare DNB... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665993Component240 TStorageN665993AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665993BIndex N925-N948 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle. Products Introduction This kit is a companion kit to the transposase-Products contentN665993Component240 TStorageN665993AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665993BIndex N925-N948 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle. Products Introduction This kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. ProcedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol.Index N501 Primer for IlluminaIndex N901-N996 Primer for Illumina... Read More |