| Description | Inquire | Product content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct IntroductionProduct content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct Introduction：This product is a specialized reagent kit for one-step Real Time RTqPCR using probe methods (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT qPCR reaction, reverse transcription and quantitative PCR are requiredConducted in the same reaction system, there is no need to add reagents or open the tube cap during the reaction process, avoiding contaminationThis has improved the efficiency of the experiment. This product has high detection sensitivity, strong fluorescence signal, and high signal-to-noise ratio, making it very suitable forDetection of RNA viruses and other trace amounts of RNA. The special buffering system it contains can enable reverse transcriptase to interact with DNA polymeraseMaximize the effectiveness and improve reaction efficiency. By using this product, a wider linear range can be obtained, which is beneficial for the target base Due to more accurate quantification, good repeatability, and high reliability.ROX dye is used to correct the fluorescence signal error generated between wells in quantitative PCR instruments, and is generally used for ABIReal Time PCR amplification equipment from companies such as Stratagene. The excitation optical systems of different instruments vary, thereforeThe concentration of ROX dye must be matched with the corresponding fluorescence quantitative PCR instrument.matters needing attention：1. Before using the reagents in this reagent kit, please gently mix them upside down to avoid foaming as much as possible, and use them after brief centrifugation. 2. This product uses RNA as a template for one-step RT-PCR experiments, and RNase contamination should be avoided during the operation process,2.It is recommended to perform RNA operations in a dedicated area, using specialized instruments and consumables. Operators should wear masks and disposable gloves and frequently change gloves. Experimental consumables should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours and sterilized under high pressure for 30 minutes before use.3. Each reagent in this kit should avoid repeated freezing and thawing as much as possible, as repeated freezing and thawing may lead to a decrease in product performance.4. This reagent kit must use specific primers, and the selection of primers can be based on specific experiments. The quality of primer design directly affects the results of RT qPCR reaction. When designing primers, GC content, primer length, and primer should be considered Due to factors such as location, secondary structure of PCR products, it is recommended to use professional primer design software for design.5. It is recommended to use specific probes in this reagent kit and use professional design software for design. Usage: The following examples are typical reaction systems and conditions. In practical operation, corresponding improvements and optimizations should be made based on the differences in template, primer structure, and target fragment size. (Please prepare the reaction solution on ice)1. Dissolve the RNA template, primers, 2xGoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix, and RNase Free Water and place them on ice for later use.2. PCR reaction system: reagent 25 µl Reaction system final concentration 2×GoldStar Probe One Step Buffer 12.5 µl 1× Forward Primer，10 µM 0.5 µl 0.2 µM 1） Reverse Primer，10 µM 0.5 µl 0.2 µM 1） Probe ，10 µM 0.5 µl 0.2 µM 2） GoldStar Probe One Step EnzymeMix 1.0 µl / RNA Template X µl 10 pg – 100 ng3） 50×Low ROX or High ROX （optional）4） 0.5 µl 1× RNase-Free Water up to 25 µl /Note: 1) Typically, the primer concentration is 0.2 µ M can achieve good results, ranging from 0.1 to 1.0 µ M serves as a reference for setting the range. 2) The concentration of the probe used is related to the fluorescent quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance. Please refer to the instrument manual or the specific usage requirements of each fluorescent probe for concentration adjustment during actual use.3) The amount of RNA templates is usually based on 10 pg-100 ng as a reference. Due to the different copy numbers of target genes contained in templates of different species, gradient dilution can be applied to the templates to determine the optimal template usage.4) The excitation optical systems of different instruments vary, and depending on the instrument used for fluorescence quantification, 50 x Low ROX or 50 x High ROX can be added.3. Mix well, centrifuge briefly, and collect the solution to the bottom of the tube.4. RT-PCR reaction conditions steps temperature time / Reverse Transcription 45℃ 10 min / PCR pre denaturation 95℃ 10 min / denaturation 95℃ 15s 30-40cycle Annealing/Extension 60℃ 45s 30-40cycleAttention:1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 5-10 minutes.2) It is recommended to use a two-step PCR reaction program. If good experimental results cannot be obtained due to the use of primers with lower Tm values, a three-step PCR amplification can be attempted. The annealing temperature should be set within the range of 56 ℃ -64 ℃ as a reference... Read More | This product can rapidly, gently, and efficiently lyse mammalian cells, effectively extracting cytoplasmic and nuclear proteins. This reagent uses a mild formula to ensure that the extracted protein maintains biological activity and can be applied to various protein analysis experiments, such as This product can rapidly, gently, and efficiently lyse mammalian cells, effectively extracting cytoplasmic and nuclear proteins. This reagent uses a mild formula to ensure that the extracted protein maintains biological activity and can be applied to various protein analysis experiments, such as reporter gene and enzyme activity determination, immune detection, protein purification, etc. The extracted protein can be quantitatively analyzed using the BCA method. The reagent kit contains a mixture of protease inhibitors, which can effectively prevent protein degradation during the protein extraction process.M665813Component100 TStorageM665813AMammalian Protein Extraction Reagent100 mLRTM665813BProtease Inhibitor Cocktail (100×)1 mL-20℃. Avoid freeze/thaw cycle. precautions1. This product can effectively lyse adherent cells cultured on cell culture plates (without scraping) and suspended cells collected by centrifugation, with higher extraction efficiency than repeated freeze-thaw or ultrasound methods. But for the extraction of tissue proteins, it is recommended to use the tissue protein extraction kit (CW0891).The optimal dosage for protein extraction from adherent cells is listed in Table 1. Collecting cells first can reduce the amount of reagents used to obtain higher protein concentrations.3. The amount of extraction reagents used can also be estimated based on the number of cells. If 2 × 106 Hela cells weigh about 20 mg, 200 need to be added µ Extract reagents.4. The protein extracted from this product can be quantitatively analyzed using the BCA method.Operation steps● Protein extraction from adherent cells1. Please remove the required Mammalian Protein Extraction Agent for pre cooling before protein extraction.2. Carefully pour out the culture medium of adherent cells and rinse the cells with PBS.3. Add an appropriate amount of Mammalian Protein Extraction Reagent (add Protein Inhibitor Cocktail in a 1:99 ratio 2-3 minutes before protein extraction), blow adherent cells on ice with a gun tip, transfer the lysate to a centrifuge tube, incubate on ice for 20 minutes, and allow the cells to fully lyse (please refer to Appendix 1 for the amount of reagent used, and the time for placing on ice should be adjusted according to different cell types). 4. Centrifuge at 14000 × g for 5-10 minutes.5. Transfer the supernatant to a new tube for further analysis. ● Suspension cell protein extraction1. Please remove the required Mammalian Protein Extraction Agent for pre cooling before protein extraction.2. Suspend 2500 × g of cells, centrifuge for 10 minutes, and discard the supernatant. Rinse cells with PBS. 2500 × g, centrifuge for 10 minutes, discard the supernatant.3. Add an appropriate amount of Mammalian Protein Extraction Agent, and 2-3 minutes before protein extraction, add Protein Inhibitor Cocktail in a ratio of 1:99, which is 1 x working solution.4. Add at least 1 ml of 1x working solution to every 100 mg of cells. If the extracted sample size is large, a small amount of 1x working solution can be used to resuspend the cells first, and then the remaining working solution can be added.5. After blowing evenly, place it on ice for 20 minutes to allow the cells to fully lyse (the time for placing it on ice should be adjusted according to different cell types). 6. Centrifuge at 14000 × g for 15 minutes.7. Transfer the supernatant to a new tube for further analysis.Table 1. Recommended usage of extraction reagents Cell culture plate type or dish type Extraction reagent usage 100 mm 500-1,000 µl 60 mm 250-500 µl 6-well culture plate 200-400 µl /well 24-well culture plate 100-200 µl /well 96-well culture plate 50-100 µl /well Table 2. Common Problems and Solutions Problem Possible reasons Resolvent Low extraction rate Low protein expression level Optimize transfection system Low extraction rate Insufficient reagent usage Increase the usage of extraction reagents Low extraction rate Reagent unable to dissolve cell membrane Increase cracking time or increase shaking amplitude Unable to obtain membrane protein This product is more suitable for extracting nuclear plasma protein Using eukaryotic cell membrane protein extraction kit... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product contentY666144Component50 TStorageY666144ABuffer P115 mLRTY666144BBuffer P215 mLRTY666144CBuffer N320 mLRTY666144DBuffer PS15 mLRTY666144EBuffer PB10 mLRTY666144FBuffer PW (concentrate)10 mLRTY666144GBuffer EB10 mLRTY666144HGlass Beads2 gRTY666144IRNase A (10mg/mL)150 µLRTY666144JSpin Product contentY666144Component50 TStorageY666144ABuffer P115 mLRTY666144BBuffer P215 mLRTY666144CBuffer N320 mLRTY666144DBuffer PS15 mLRTY666144EBuffer PB10 mLRTY666144FBuffer PW (concentrate)10 mLRTY666144GBuffer EB10 mLRTY666144HGlass Beads2 gRTY666144IRNase A (10mg/mL)150 µLRTY666144JSpin Columns DM with Collection Tubes50 setsRTProductsThis kit is improved on the basis of common alkaline lysis method, the glass beads can effectively break the yeast cell wall, the new silica matrix membrane and buffer system can efficiently and specifically bind the plasmid DNA, and at the same time can maximize the removal of proteins and other impurities, the whole process is convenient and fast, no need to use toxic and harmful reagents, and can be processed at the same time for multiple samples. In addition to yeast cells, it can also be used in E. coli. Plasmid DNA extracted with this kit can be used in various molecular biology experiments, such as ligation, transformation, sequencing and library screening.Self-contained reagents: β-mercaptoethanol, anhydrous ethanol.Pre-experiment Preparation and Important Notes1. All components can be stably stored in dry, room temperature (15-30℃) environment for 1 year, the adsorption column can be stored at 2-8℃ for a longer period of time, and Buffer P1 with RNase A can be stably stored at 2-8℃ for 6 months.2. Before the first use, add all the RNase A solution to Buffer P1, mix well, and store at 2-8℃.3. Anhydrous ethanol should be added to Buffer PW before first use according to the instructions on the reagent bottle label.4. Before use, please check whether Buffer P2 and Buffer N3 are crystallized or precipitated. If there is any crystallization or precipitation phenomenon, it can be clarified by taking a water bath at 37℃ for a few minutes to restore the clarity.5. Be careful not to touch Buffer P2 and Buffer N3 directly, and tighten the lid immediately after use.6. The amount of plasmid extracted is related to the yeast strain, plasmid copy number, culture conditions, etc. Usually, yeast plasmid copy number is very low, which is difficult to be detected by electrophoresis or spectrophotometer method.Procedure1. Take 1-5 ml of yeast culture (maximum 5×107 yeast cells, generally for Saccharomyces cerevisiae OD = 1.0, equivalent to 1-2×107 cells/ml) and add it to a centrifuge tube (self-provided), centrifuge for 30 seconds at 12,000 rpm (~13,400×g), collect the bacterial precipitate, and aspirate as much as possible to discard the supernatant.2. Add 250µl Buffer P1 to the bacterium (please check if RNase A has been added first) and resuspend the precipitate.3. Add 40mg of Glass Beads to the above mixture and vortex and shake for 10 minutes.4. Add 250 µl of Buffer P2 to the centrifuge tube, mix gently by turning up and down 6-8 times, and let stand at room temperature for 5-10 minutes, at which time the bacterial solution should become clear and viscous.Note: Mix gently, do not shake violently, so as not to interrupt the genomic DNA, resulting in genomic DNA fragments mixed in the extracted plasmid. If the solution does not become clear, it suggests that the amount of bacteria may be too large and the lysis is not complete, and the amount of bacteria should be reduced.5. Add 350 µl of Buffer N3 to the centrifuge tube and immediately mix gently up and down 6-8 times, at which point a white flocculent precipitate appears, and centrifuge at 12,000 rpm for 20 minutes.Note: Buffer N3 should be mixed immediately after addition to avoid localized precipitation.6. Column Equilibration: Add 200 µl of Buffer PS to the Spin Columns DM in the collection tube, centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid from the collection tube, and place the column back into the collection tube.7. Add the supernatant from step 5 to the adsorbent column that has been loaded into the collection tube, taking care not to aspirate the precipitate.Note: The maximum volume of the adsorption column is 750 µl, and the solution is passed through the column in 2 times.8. Centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube and place the adsorption column back into the collection tube.9. Add 150 µl Buffer PB to the adsorbent column, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.10. Add 750 µl Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first), centrifuge at 12,000 rpm for 1 minute, and pour off the waste liquid in the collection tube.11. Place the column back into the recovery collection tube and centrifuge at 12,000 rpm for 2 minutes, pouring off the waste liquid. Leave the column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).12. Place the adsorbent column in a new centrifuge tube, add 50-100 µl of Buffer EB to the center of the adsorbent membrane dropwise, let it stand at room temperature for a few minutes, centrifuge at 13,000 rpm for 1 minute, and collect the plasmid solution into the centrifuge tube. Store the plasmid at -20°C.Attention:1) To increase the recovery efficiency of the plasmid, the resulting solution can be reintroduced into the adsorbent column, left at room temperature for a few minutes, centrifuged at 13,000 rpm for 1 minute, and the plasmid solution collected into a centrifuge tube.2) When the plasmid copy number is low or >10 kb, Buffer EB is preheated at 65-70°C in a water bath, which can increase the extraction efficiency.3) Usually yeast plasmids have very low copy number and are difficult to detect by electrophoresis or spectrophotometry. If the extracted plasmid is to be used in the next step of the experiment, it is usually recommended to use 1-5µl of the plasmid as PCR template, and 5-10µl of the plasmid for transformation of E. coli.4) Commercial high transformation efficiency receptor cells should be used for transformation of E. coli... Read More |