| Description | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-ethynyl-2 '-Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-ethynyl-2 '- deoxyuridine) is a pyrimidine analog that integrates into the DNA duplex during DNA synthesis. Edu detection is based on the "click" reaction. A copper catalyzed azide reacts covalently with alkynes to form covalent bonds. In this kit, edu contains alkynes, Aladdin ® 488 / 555/594/647a azide dyes contain azide compounds. The edu labeling proliferation of click method is rapid and effective, and easy to use. BrdU method requires DNA denaturation (such as acid denaturation, thermal denaturation or digestion with DNase) to expose BrdU, so as to facilitate BrdU antibody binding; The edu method only needs paraformaldehyde fixation and Triton X-100 penetration to make the detection reagent enter the cells, and only a small amount of azide dye is needed to label the integrated edu very effectively. This kit contains all components required for edu method detection, and can be used for proliferation detection of cultured cells in vitro. Component:Product parameters: 590/617 nm Instruction:Experimental materials (self provided). 10 mM PBS, pH 7.2-7.6. 4% paraformaldehyde fixing solution (in PBS)Propensive reagent (0.5% Triton X -100 in PBS). 2 mg/mL glycine solution (in ddH2O). 3% BSA in PBS, pH 7.2-7.6. 1% BSA in PBS, pH 7.2-7.6. ddH2O. 96/24/12/6 well culture plate or dishFluorescence microscopy detection method1. Cell cultureTake logarithmic growth stage cells and inoculate them into a 96 well plate with 4 × 103-1 × 105 cells per well (the number and density of cells can be adjusted according to cell size, growth rate, and specific requirements of experimental treatment), and culture until normal growth stage.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU marking(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to incubation time,Short term incubation (<2 hours) should use high concentrations, such as 10-50 µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash the cells twice with a 3% BSA washing solution after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, remove the culture medium. Wash cells twice with 1X PBS for 5 minutes each time to remove EdU residues that have not been incorporated into DNA. Cells with weak adhesion can reduce cleaning intensity. Join 50 µ After incubating at room temperature for 20 minutes with 4% paraformaldehyde fixative, remove the fixative.(2) Add 50 to each hole µ L 2 mg/mL glycine solution, incubate at room temperature for 5 minutes, and neutralize the remaining fixed solution.(3) At a rate of 100 per hole µ Wash cells twice with 3% BSA.(4) Remove the washing solution and add 100 µ L 0.5% Triton X -100, incubate at room temperature for 10 minutes.5. EdU detectionNote: Each sample in this reference step uses 100 µ The working fluid of L can be adjusted by users according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer (component C): Dilute component C 10 times with ddH2O.(2) Configure 5 x Click iT EdU buffer additives (component E): add 300 µ Mix L of ddH2O into a 30 mg E component tube (final concentration of 100 mg/mL) until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio, and prepared into a 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 1.Table 1 Click it working fluid Reaction components Taking the sample size of 10 holes as an example 1 x Click it EdU reaction buffer 855 µL CuSO4 (component D) 40 µL YF® 488/555/594/647A Azide(Component B) 5 µL 1 x Click it EdU buffer additive 100 µL Total volume 1 mL (5) Remove penetration enhancer, 100 per well µ Wash twice with 3% BSA washing solution of L.(6) Add 100 to each hole µ L Click iT working solution, evenly covering cells.(7) Incubate at room temperature in dark for 30 minutes.(8) Remove Click-iT working fluid and add 100 µ After washing cells twice with 3% BSA, remove the washing solution and add 100 µ L PBS keeps cells moist. If there are no other special requirements, photography analysis can be carried out.6. DNA re staining (optional)(1) Using 100 µ Wash the cells once with PBS and remove the washing solution.(2) Dilute Hoechst 33342 (component F) 2000 times with PBS.(3) Add 100 to each hole µ Incubate L 1 x Hoechst 33342 solution at room temperature in dark for 15-30 minutes.(4) Remove Hoechst 33342 solution and use 100 µ Wash cells twice with PBS.7. Imaging and analysisIt is recommended to take fluorescence microscopy photos immediately after staining is completed for observation; If conditions permit, please store in a dark and moist environment at 4 ° C for 3 days before taking photos. Flow cytometry detection method1. Cell cultureInoculate 1 × 105~3 × 106 cells per well into a 6-well plate.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU labeled cells(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours. The time of EdU incubation of cells can be directly used as an indicator for measuring cell DNA synthesis, and the choice of time point and incubation time depend on the cell growth rate. Pulse labeled cells incubated with brief EdU can be used to study cell cycle dynamics.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to the incubation time, and high concentrations, such as 10-50, should be used for short-term incubation (<2 hours) µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash cells twice with 1% BSA after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, collect cells, add 1 mL of PBS to each tube to clean the cells, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant to remove EdU residue that has not been added to DNA.(2) Add 1 mL of 4% paraformaldehyde fixative to each tube to resuspend cells.(3) Incubate at room temperature for 20 minutes, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(4) Add 1 mL of 2 mg/mL glycine to each tube and incubate for 5 minutes. Neutralize the remaining fixed solution, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant. Add 1 mL of PBS to each tube for cleaning once, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(5) Add 1mL of 0.5% Triton X-100 osmotic enhancer to each tube and resuspend cells. Incubate at room temperature for 10 minutes.5. EdU detectionNote: For 6-well plate samples, reference can be made to 1 mL of working solution per well. Users can adjust the dosage according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer: Dilute component C 10 times with ddH2O.(2) Prepare 5 x Click iT EdU buffer additives (component E): Add 300 µ L ddH2O to 30 mg of component E in a test tube (final concentration 100 mg/mL), mix well until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio to form 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive storage solution with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 2.Table 2 Click it working fluid Reaction components Volume of liquid required for a single reaction 1×Click-iT EdU reaction buffer 875 µL CuSO4 (component D) 20 µL YF® 488/555/594/647A Azide(Component B) 5 µL 1×Click-iT EdU buffer additive 100 µL Total volume 1 mL (5) Soak at 1000 rpm for 5 minutes, discard the supernatant, remove the enhancer, add 1mL of 1% BSA washing solution to each tube and wash twice. Soak at 1000 rpm for 5 minutes, discard the supernatant.(6) Add 1 mL of Click iT working solution to each tube and mix well.(7) Incubate at room temperature in dark for 30 minutes.(8) Soak at 1000 rpm for 5 minutes, discard the staining reaction solution, add 1% BSA to each tube to wash the cells twice, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the cells again with 1 mL of 1% BSA (the volume of resuspend cells can be adjusted according to the number of cells), and detect with a flow cytometer.Note: If other biomarker tests are required, please refer to step 4.6. Intracellular antigen labeling (optional steps)(1) Add antibody working solution and mix well.(2) Under dark conditions, incubate antibodies at appropriate temperature and time.7. Flow detection and analysis:(1) It is recommended to conduct flow cytometry testing immediately after dyeing is completed; If conditions are limited, please store in a dark place at 4 ℃ for testing, but it should not exceed 3 days.(2) It is recommended to test the number of cells up to one million levels as much as possible. If the number of cells is small, the number of cells tested can be adjusted to 100000 levels starting from the experiment. For cases where the cell yield is too low (just to the level of ten thousand), it may not be conducive to making a flow chart. Therefore, the cleaning frequency in step 5 (8) can be appropriately reduced.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. fluorescent dyes have quenching problems. Please try to avoid light during experimental operation to slow down fluorescence quenching. 3. click it edu buffer additive solution should be prepared and used immediately to ensure the best results. 4. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application:Cell proliferation detection (cell imaging flow universal)... Read More | This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. Purified lactose antibodies were coated on a microplate to produce solid-phase antibodies. Lactose was added to the microplate of the coated monoclonal antibody, along with HRP labeled lactose antigens, to compete for binding. After thorough washing, the substrate TMB was added for colorimetry. The depth of sample color is negatively correlated with the content of lactose in the sample. Measure the absorbance (OD value) at a wavelength of 450nm using an enzyme-linked immunosorbent assay (ELISA) reader, and calculate the content of lactose in the sample through a standard curve.Kit composition:130times concentrated washing solution20ml×1 bottle8.1Standard S1(80µg/L)0.5ml×1bottle2Enzyme-linked immunosorbent assay6ml×1 bottle8.2Standard S2(40µg/L)0.5ml×1bottle3Enzyme labeling coated plate96 holes x 1 pieces8.3Standard S3(20µg/L)0.5ml×1bottle4Color reagent A solution6ml×1 bottle8.4Standard S4(10µg/L)0.5ml×1bottle5Color developer B solution6ml×1 bottle8.5Standard S5(5µg/L)0.5ml×1bottle6Stop solution6ml×1 bottle9Instructions1 copy7Sample Diluent6ml×1 bottle10Microplate Sealers2 sheetsSpecimen requirements:1. Specimen processing:(1) After collecting the water sample, it is repeatedly freeze-thawed three times at -20 ℃, and then filtered through glass fiber for future reference(2) The tissue samples should be extracted using butanol: methanol: water (5:25:70 V: V: V), or extracted according to relevant literature. The experiment should be conducted as soon as possible after extraction. If the experiment cannot be conducted immediately, the specimen can be stored at -20 ℃ for future reference2. Samples containing NaN3 cannot be detected as NaN3 inhibits the activity of horseradish peroxidase (HRP).Operation steps:1. Sample addition: Set up standard wells, blank wells (blank control wells do not include samples and enzyme-linked immunosorbent assay reagents, the other steps are the same), and sample wells to be tested. Add 50 microliters to the standard well on the enzyme-linked immunosorbent assay (ELISA) plate, and first add 40 diluents to the sample well to be tested µ l. Then add 10 more samples to be tested µ L (The final dilution of the sample is 5 times). Add the sample to the bottom of the enzyme-linked immunosorbent assay (ELISA) plate well, avoiding touching the well wall as much as possible. Gently shake and mix well.2. Enzyme addition: Add 50 enzyme labeled reagents to each well µ l. Excluding blank holes.3. Warm incubation: Seal the plate with a sealing film and incubate at 37 ℃ for 60 minutes.4. Solution preparation: Dilute 30 times the concentrated washing solution with distilled water and set aside for later use5. Washing: Carefully remove the sealing film, discard the liquid, shake dry, fill each well with washing solution, let it stand for 30 seconds, then discard. Repeat this process 5 times and pat dry.6. Color development: Add color development agent A50 to each well first µ l. Add color developer B50 again µ l. Gently shake and mix well, and develop color at 37 ℃ in the dark for 15 minutes7. Termination: Add 50% termination fluid to each hole µ l. Terminate the reaction (at this point, the blue color immediately turns yellow).8. Measurement: Zero the blank hole and sequentially measure the absorbance (OD value) of each hole at a wavelength of 450nm. The measurement should be conducted within 15 minutes after adding the termination solution.Calculation:Draw a standard curve on a coordinate paper with the concentration of the standard substance as the x-axis and the OD value as the y-axis. Based on the OD value of the sample, determine the corresponding concentration from the standard curve; Multiply it by the dilution factor; Alternatively, a linear regression equation can be used to calculate the standard curve using the concentration and OD value of the standard substance. The OD value of the sample can be substituted into the equation to calculate the sample concentration, which is then multiplied by the dilution factor to obtain the actual concentration of the sample.Notes:1. The kit should be balanced at room temperature for 15-30 minutes before use when taken out from the cold storage environment. If the enzyme coated plate is not used up after opening, the Flat noodles should be stored in a sealed bag.2. Concentrated detergent may precipitate crystals. When diluted, it can be heated in a water bath to aid in dissolution. Washing does not affect the results.3. A sampler should be used for each step of sample addition, and its accuracy should be regularly calibrated to avoid experimental errors. It is best to control the sample addition time within 5 minutes. If there are a large number of specimens, it is recommended to use a firing gun for sample addition.4. Please make a standard curve at the same time as each measurement, preferably with a re hole. If the content of the substance to be tested in the sample is too high (the OD value of the sample is greater than the OD value of the first well of the standard well), please dilute the sample diluent by a certain multiple (n times) before measurement. When calculating, please multiply the total dilution multiple (x n x 5).5. The sealing film is only for one-time use to avoid cross contamination.6. Please store the substrate in dark.7. Strictly follow the instructions and determine the test results based on the reading of the enzyme-linked immunosorbent assay (ELISA) reader8. All samples, washing liquids, and various waste should be treated as infectious substances.9. The components of this reagent with different batch numbers shall not be mixed.Detection range:two µ G/L-90 µ G/L... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |