| Description | Inquire | Inquire | Store at -20°C. Please refer to protocols | This product can rapidly, gently, and efficiently lyse mammalian cells, effectively extracting cytoplasmic and nuclear proteins. This reagent uses a mild formula to ensure that the extracted protein maintains biological activity and can be applied to various protein analysis experiments, such as This product can rapidly, gently, and efficiently lyse mammalian cells, effectively extracting cytoplasmic and nuclear proteins. This reagent uses a mild formula to ensure that the extracted protein maintains biological activity and can be applied to various protein analysis experiments, such as reporter gene and enzyme activity determination, immune detection, protein purification, etc. The extracted protein can be quantitatively analyzed using the BCA method. The reagent kit contains a mixture of protease inhibitors, which can effectively prevent protein degradation during the protein extraction process.M665813Component100 TStorageM665813AMammalian Protein Extraction Reagent100 mLRTM665813BProtease Inhibitor Cocktail (100×)1 mL-20℃. Avoid freeze/thaw cycle. precautions1. This product can effectively lyse adherent cells cultured on cell culture plates (without scraping) and suspended cells collected by centrifugation, with higher extraction efficiency than repeated freeze-thaw or ultrasound methods. But for the extraction of tissue proteins, it is recommended to use the tissue protein extraction kit (CW0891).The optimal dosage for protein extraction from adherent cells is listed in Table 1. Collecting cells first can reduce the amount of reagents used to obtain higher protein concentrations.3. The amount of extraction reagents used can also be estimated based on the number of cells. If 2 × 106 Hela cells weigh about 20 mg, 200 need to be added µ Extract reagents.4. The protein extracted from this product can be quantitatively analyzed using the BCA method.Operation steps● Protein extraction from adherent cells1. Please remove the required Mammalian Protein Extraction Agent for pre cooling before protein extraction.2. Carefully pour out the culture medium of adherent cells and rinse the cells with PBS.3. Add an appropriate amount of Mammalian Protein Extraction Reagent (add Protein Inhibitor Cocktail in a 1:99 ratio 2-3 minutes before protein extraction), blow adherent cells on ice with a gun tip, transfer the lysate to a centrifuge tube, incubate on ice for 20 minutes, and allow the cells to fully lyse (please refer to Appendix 1 for the amount of reagent used, and the time for placing on ice should be adjusted according to different cell types). 4. Centrifuge at 14000 × g for 5-10 minutes.5. Transfer the supernatant to a new tube for further analysis. ● Suspension cell protein extraction1. Please remove the required Mammalian Protein Extraction Agent for pre cooling before protein extraction.2. Suspend 2500 × g of cells, centrifuge for 10 minutes, and discard the supernatant. Rinse cells with PBS. 2500 × g, centrifuge for 10 minutes, discard the supernatant.3. Add an appropriate amount of Mammalian Protein Extraction Agent, and 2-3 minutes before protein extraction, add Protein Inhibitor Cocktail in a ratio of 1:99, which is 1 x working solution.4. Add at least 1 ml of 1x working solution to every 100 mg of cells. If the extracted sample size is large, a small amount of 1x working solution can be used to resuspend the cells first, and then the remaining working solution can be added.5. After blowing evenly, place it on ice for 20 minutes to allow the cells to fully lyse (the time for placing it on ice should be adjusted according to different cell types). 6. Centrifuge at 14000 × g for 15 minutes.7. Transfer the supernatant to a new tube for further analysis.Table 1. Recommended usage of extraction reagents Cell culture plate type or dish type Extraction reagent usage 100 mm 500-1,000 µl 60 mm 250-500 µl 6-well culture plate 200-400 µl /well 24-well culture plate 100-200 µl /well 96-well culture plate 50-100 µl /well Table 2. Common Problems and Solutions Problem Possible reasons Resolvent Low extraction rate Low protein expression level Optimize transfection system Low extraction rate Insufficient reagent usage Increase the usage of extraction reagents Low extraction rate Reagent unable to dissolve cell membrane Increase cracking time or increase shaking amplitude Unable to obtain membrane protein This product is more suitable for extracting nuclear plasma protein Using eukaryotic cell membrane protein extraction kit... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |