| Description | Hotstart HiTaq& Script III combines high-speed thermal cycling with exceptional quantification accuracy. Featuring a thermostable reverse transcriptase (HS Script III RTase) and chemical-modified hot-start Taq DNA polymerase (Hotstart HiTaq), it enables contamination-resistant, single-tube Real-Hotstart HiTaq& Script III combines high-speed thermal cycling with exceptional quantification accuracy. Featuring a thermostable reverse transcriptase (HS Script III RTase) and chemical-modified hot-start Taq DNA polymerase (Hotstart HiTaq), it enables contamination-resistant, single-tube Real-Time One-Step RT-PCR with superior sensitivity—ideal for detecting low-abundance RNA targets (e.g., RNA viruses). This master mix is specifically designed for convenient, high-sensitivity one-step RT-PCR. Its unique enzyme system and specially formulated buffer ensure efficient and accurate reverse transcription and PCR amplification without requiring optimization. It delivers excellent standard curves across a broad quantitative range, enabling precise target gene quantification with high reproducibility and reliability. Suitable for hot-start RNA amplification.Product Component ListU1492576Component100T200TStorageU1492576A4×RT PCR Buffer625 µL2.5 mL-20℃U1492576BHotstart HiTaq& Script III100 µL400 µL-20℃.Protocol1. Pre-Reaction SetupThaw components on ice. Avoid freeze-thaw cycles.Prepare reactions on ice.2. Reaction AssemblyComponentVolume/25 µLVolume/50 µLFinal Concentration4×RT PCR Buffer6.25 µL12.5 µL1×Hotstart HiTaq& Script III1 µL2 µL2/50 µLPrimer-Probe Mix1 µL2 µL/Template (RNA)5 µL10 µL/ddH2OTo 25 µLTo 50 µL/Total Volume25 µL50 µL* Enzyme activity: 2 U Hotstart HiTaq + 5 U HS Script III per 50 µL reactionNotes:Adjust primer/probe/template volumes as needed.Protect probes from light.3. Mixing & CentrifugationGently pipette-mix → Centrifuge briefly.4. Cycling ConditionsStepTemperatureTimeCyclesReverse Transcription50℃15min1Initial Denaturation95℃10min1Denaturation95℃10s45Annealing/Extension55℃40s45Hold12℃∞1... Read More | Products Content:F666101Component500 U5000 UStorageF666101AFastStar Probe Buffer (for bisDNA)2×1.2 mL2×12 mL-20℃. Avoid freeze/thaw cycle. Protect from light.F666101BSuperFastStar DNA Polymerase (5U/µL)100 µL1 mL-20℃. Avoid freeze/thaw cycle. Protect from light.Products Content:F666101Component500 U5000 UStorageF666101AFastStar Probe Buffer (for bisDNA)2×1.2 mL2×12 mL-20℃. Avoid freeze/thaw cycle. Protect from light.F666101BSuperFastStar DNA Polymerase (5U/µL)100 µL1 mL-20℃. Avoid freeze/thaw cycle. Protect from light.Products IntroductionThis product is mainly used for PCR using bisulfite-treated DNA as template, in which SuperFastStar DNA Polymerase is a new high-efficiency hot-start enzyme modified by bis-monoclonal antibody, which is completely blocked at room temperature, thus effectively avoiding non-specific amplification caused by the non-specific binding of the primer to the template or the primer dimerization under the condition of room temperature. The optimized FastStar Probe Buffer (for bisDNA) contains PCR Buffer, dNTPs and Mg2+, etc., which is easy to use as customers only need to add templates, primers and probes.caveat1 Before use, please mix the product gently by turning it up and down after it has been completely melted and centrifuged briefly.2. Avoid repeated freezing and thawing of the product, which may degrade its performance. This product can be stored at -20℃ for a long period of time, protected from light. If frequent use is required within a short period of time, it can be stored at 2-8℃.Usage The following examples are conventional PCR reaction systems and conditions, which should be improved and optimized according to the template, primer structure and target fragment size.1.PCR reaction system Note: 1) Usually, better results can be obtained with a primer concentration of 0.2 µM, and 0.1-1.0 µM can be used as a reference for setting the range.2）The concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, so please refer to the instrument manual or the specific requirements for the use of each fluorescent probe to adjust the concentration.3）Usually the amount of DNA template is 10-100 ng of genomic DNA or 1-10 ng of cDNA as a reference. Since the templates of different species contain different copy numbers of the target gene, the templates can be diluted in gradients to determine the optimal amount of template to use.2.PCR reaction conditionsNote: 1) The initial denaturation of this product at 95°C for 30s is sufficient for enzyme activation; complex templates can be extended to 3min denaturation.(2) It is recommended to use two-step PCR reaction program, if you can't get good experimental results due to the use of primers with lower Tm value, etc., you can try three-step PCR amplification, and the annealing temperature should be set in the range of 56℃-64℃ as a reference... Read More | Product content: M665794Component125 TStorageM665794A2×miRNA qPCR Mixture (ROX)2×750 µL-20℃. Avoid freeze/thaw cycleM665794BReverse Primer, 10 µM60 µL-20℃. Avoid freeze/thaw cycleM665794CddH2O1.5 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kitProduct content: M665794Component125 TStorageM665794A2×miRNA qPCR Mixture (ROX)2×750 µL-20℃. Avoid freeze/thaw cycleM665794BReverse Primer, 10 µM60 µL-20℃. Avoid freeze/thaw cycleM665794CddH2O1.5 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kit uses the principle of SYBR Green I chimeric fluorescent dye method for miRNA fluorescence quantitative PCR detection. The kit includes 2 x miRNA qPCR Mixture and Reverse Primer required for detection. 2 x miRNA qPCR Mixture is a new generation pre mixed form of fluorescence quantitative PCR detection reagent specially developed for miRNA quantitative detection. The fluorescent dye SYBR Green I contained in it can bind to all double stranded DNA, making the product suitable for detecting different target sequences without the need to synthesize specific labeled probes. The GoldStar Taq DNA polymerase is a chemically modified and highly efficient thermal starter enzyme, coupled with a unique buffer system, which enhances reaction specificity, sensitivity, and enables accurate quantification of miRNA over a wider range. The 2x miRNA qPCR Mixture contains ROX dye and is suitable for fluorescence quantitative PCR instruments that require ROX as a calibration dye.Note: This kit must be used in conjunction with the miRNA cDNA first strand synthesis kit.Self prepared experimental materials: qPCR upstream primer.Forward Primer design principles:1. Follow the most common principles of primer design.2.Based on mature miRNA sequences, replacing U with T is the most basic and simplest design method.3.The Tm value of the downstream primer provided in the reagent kit is 63.6 ℃, and the Tm value of the upstream primer should be designed to be around 63.6 ℃ as much as possible.4. If the Tm value of the primer directly designed according to principle "2" is too low, several bases (preferably G or C bases) can be added to the 5 'end of the primer; One or several A bases can also be added at the 3 'end; Alternatively, both the 5 'and 3' ends can be modified simultaneously.5.If the Tm value of a primer designed directly according to principle "2" is too high, several bases can be removed from the 5 'or 3' end of the primer.Notes:1. Before using the reagent, please gently mix it upside down to avoid foaming, and use it after a brief centrifugation.2. The amount of miRNA first strand cDNA added should not exceed 10% of the volume of Real time PCR.3. For special detection systems, high content of cDNA templates can easily lead to non-specific amplification. Dilute cDNA appropriately (10 or 100 times dilution) based on the abundance of detected miRNAs.4. The 2x miRNA qPCR Mixture in this product contains SYBR Green I and ROX dyes. When storing this product or preparing PCR reaction solution, strong light exposure should be avoided.5. Avoid repeated freezing and thawing of this product. Repeated freezing and thawing may cause a decrease in product performance. This product can be stored at -20 ℃ for long-term storage. If frequent use is required in the short term, the 2xmiRNA qPCR Mixture can be stored at 2-8 ℃. However, the Reverse primer still needs to be stored at -20 ℃.Operation steps:1. Melt 2 x miRNA qPCR Mixture and Reverse Primer at room temperature (10 µ M). 2. When using, please gently mix the 2x miRNA qPCR Mixture upside down to avoid foaming, and use after brief centrifugation. If the reagent is not well mixed, its reaction performance will decrease.3. Place the reagent on ice and prepare the reaction system according to the following table: reagent volume final concentration 2×miRNA qPCR Mixture（ROX） 10 µl 1× Forward primer（10 µM） 0.4µl 0.2 µM Reverse primer（10 µM） 0.4µl 0.2 µM MiRNA first strand cDNA X µl — ddH2O up to 20 µl —4. The reaction program is set as follows:Attention!The pre denaturation reaction of this product must be completed at 95 ℃ for 10 minutes! Note: 1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 10 minutes.2) The annealing temperature should be set at 60-64 ℃ as a reference range. When non-specific reactions occur, the annealing temperature can be increased... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes 50 RT V669947H RNase-Free Centrifuge Tubes (1.5 mL) 50 RTProductsThis kit is suitable for the extraction of viral RNA and DNA from fresh or frozen plasma, serum and cell-free body fluids. It is easy to operate as it does not require the use of organic solvents such as phenol and chloroform for extraction. The kit uses a unique buffer system to enable efficient and specific binding of viral nucleic acids in lysate to silica gel centrifugal adsorption columns. Inhibitors of PCR and enzyme reactions as well as residual impurities can be efficiently removed in a two-step effective rinsing step, and finally high purity viral nucleic acids can be obtained by using a low-salt buffer or water for elution. The purified viral nucleic acid is free of protein, nuclease and other impurities, and can be used directly in PCR, RT-PCR, Real-Time PCR, blotting experiments and so on.Self-contained reagent: anhydrous ethanol.Pre-experiment and Important Notes1. Add 1.25ml Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time, and avoid repeated freezing and thawing to avoid affecting its activity. Do not add Proteinase K directly into Buffer GL.2. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller DNA fragments and a decrease in the amount of extracted DNA.3. Avoid repeated freezing and thawing of serum or plasma, which can lead to protein denaturation or precipitation, reducing the viral titer and thus affecting the yield of extracted viral nucleic acids.4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the label instructions of the reagent bottle before first use.5. Check Buffer GL for crystallization or precipitation before use. If crystallization or precipitation occurs, redissolve Buffer GL in a water bath at 56℃.Procedure1. Take a 1.5 ml centrifuge tube (self-provided) and add 20 µl Proteinase K.2. Add 200 µl serum or plasma to the centrifuge tube. Add 200µl Buffer GL and vortex and shake for 15 seconds.Note: 1) Sample volume less than 200 µl can be made up by adding 0.9% NaCl (self-provided). 2) In order to ensure effective lysis of the sample, the sample needs to be mixed well with Buffer GL after adding Buffer GL.3. Incubate at 56°C for 15 minutes, centrifuge briefly, and collect the solution from the wall of the tube to the bottom of the tube.4. 250 µl of anhydrous ethanol was added, vortexed and shaken for 15 seconds, left at room temperature for 5 minutes, centrifuged briefly, and the solution on the wall of the tube was collected at the bottom of the tube.Note: If the ambient temperature exceeds 25°C, anhydrous ethanol should be used after pre-cooling on ice.5. Add the solution obtained in step 4 to the adsorbent column (RNase-Free Columns RS) that has been loaded into the collection tube, and if the solution cannot be added at one time, it can be transferred in several times. centrifuge the column at 12,000 rpm (~13,400 × g) for 1 min, pour off the waste liquid in the collection tube, and put the column back into the collection tube.6. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.7. Add 500 µl of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 7 can be repeated if further DNA purity is required.8. Add 500 µl of anhydrous ethanol to the adsorbent column and centrifuge at 12,000 rpm for 1 min. Pour off the waste liquid in the collection tube and put the adsorbent column back into the collection tube.9. Centrifuge at 12,000 rpm for 3 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is the removal of residual ethanol from the adsorbent column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).10. Place the adsorption column in a new collection tube (RNase-Free Centrifuge Tube), add 20-150 µl of Buffer RE or sterilized water overhanging the middle of the adsorption column membrane, leave it at room temperature for 2-5 minutes, and then centrifuge it at 12,000 rpm for 1 minute to collect the nucleic acid solution.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on the elution efficiency, if water is used as the eluent it should be ensured that its pH is 7.0-8.5 (the pH of water can be adjusted to this range with NaOH), and the elution efficiency is not high when the pH is lower than 7.0.(2) For long-term storage, please store the DNA solution at -20℃ and the RNA solution at -70℃.3) If the final concentration of DNA/RNA is to be increased, the DNA/RNA eluate obtained in step 10 can be re-spiked onto the adsorbent membrane and step 10 repeated... Read More |