| Description | Free Fatty Acids (FFA), also known as Non-Esterified Fatty Acids (NEFA), are primarily produced by the hydrolysis of neutral fats. They are intermediate products in fat metabolism, involved in cell proliferation, inflammatory responses, and hormone regulation. FFA can also act as signaling moleculesFree Fatty Acids (FFA), also known as Non-Esterified Fatty Acids (NEFA), are primarily produced by the hydrolysis of neutral fats. They are intermediate products in fat metabolism, involved in cell proliferation, inflammatory responses, and hormone regulation. FFA can also act as signaling molecules with various physiological functions. Free fatty acids are closely related to lipid metabolism, glucose metabolism, and endocrine function. Their concentration is an important physiological and biochemical indicator, serving as an auxiliary parameter for disease evaluation and diagnosis, and also reflecting quality changes during food storage.Detection Principle: FFAs combine with copper ions to form copper soaps, which are soluble in chloroform. The copper ions can then react with a chromogenic solution to form a purplish-red complex. This product has a characteristic absorption peak at 550 nm. The FFA content can be quantified by measuring the change in absorbance.Detection Range: 0.0313 - 2 mMSensitivity: 0.0156 mMApplicable Samples: Serum (plasma), animal/plant tissues, cells, bacteria.A1492746Component48T96TStorageA1492746ACu Reagent6 mL12 mL2-8℃. Store in the dark.A1492746BChromogen15 mL30 mL2-8℃. Store in the dark.A1492746CStandard (16.41 mg Palmitic Acid)1 EA1 EA2-8℃. Store in the dark.User-Prepared Instruments and ReagentsMicroplate reader or visible spectrophotometer (capable of measuring absorbance at 550 nm)Incubator, Ice maker, Low-temperature centrifuge96-well plate or micro glass cuvettes, Adjustable pipettes and tipsHomogenizer (for tissue samples)Glass bottle (for preparing extraction buffer)n-Heptane, Anhydrous methanol, ChloroformExperimental Procedure1. Reagent PreparationReagent NameReagent PreparationPrecautionsExtraction Buffer (Self-prepared)In a glass bottle, mix Chloroform : n-Heptane : Anhydrous Methanol = 28 : 21 : 1. Cap tightly and mix well.Store at 4°C protected from light.Cu ReagentReady-to-use; equilibrate to room temperature before use; mix well before use.Store at 4°C protected from light.ChromogenReady-to-use; equilibrate to room temperature before use.Store at 4°C protected from light.StandardBefore use, dissolve contents in 1 mL of Extraction Buffer to obtain a 64 mM Standard solution. Mix well.Unused dissolved Standard can be stored in a tightly sealed glass bottle at 4°C protected from light for 1 month.2. Standard Curve SetupDilute the 64 mM Standard further with Extraction Buffer as shown in the table below.Standard No.Standard (µL)Extraction Buffer Volume (µL)Standard Concentration (mM)Std.120µL of 64mM stock6202Std.2100µL of Std.11001Std.3100µL of Std.21000.5Std.4100µL of Std.31000.25Std.5100µL of Std.41000.125Std.6100µL of Std.51000.0625Std.7100µL of Std.61000.0313Note: Prepare freshly diluted standards for each experiment.3. Sample PreparationNote: Fresh samples are recommended. If not used immediately, samples can be stored at -80°C for up to 6 months.3.1 Animal Tissues: Weigh approximately 0.1 g of tissue, add 1 mL of Extraction Buffer, and homogenize on ice. Centrifuge at 8,000 rpm, 4°C for 10 min. Collect the supernatant and keep on ice for detection.3.2 Plant Tissues: Weigh approximately 0.1 g of tissue, add 1 mL of Extraction Buffer, and grind. Disrupt by ultrasonic homogenization on ice (power 20% or 200 W, ultrasonicate for 3 s, interval 7 s, repeat 30 times). Centrifuge at 8,000 rpm, 4°C for 10 min. Collect the supernatant and keep on ice for detection.3.3 Cells or Bacteria: Collect 5 million cells or bacteria into a centrifuge tube. Wash with cold PBS, centrifuge, and discard the supernatant. Add 1 mL of Extraction Buffer. Disrupt by ultrasonic homogenization on ice (power 20% or 200 W, ultrasonicate for 3 s, interval 7 s, repeat 30 times). Centrifuge at 8,000 rpm, 4°C for 10 min. Collect the supernatant and keep on ice for detection.3.4 Serum (Plasma) and other liquids: Detect directly.4. Assay Steps4.1 Instrument Preparation: Preheat the microplate reader or visible spectrophotometer for at least 30 minutes. Set the wavelength to 550 nm. For spectrophotometers, zero the instrument with deionized water.4.2 Sample Assay (Add reagents sequentially to EP tubes):ReagentBlank Tube (µL)Standard Tube (µL)Test Tube (µL)Extraction Buffer240200200Various Std.0400Sample0040Cap the tubes tightly and vortex at medium speed for 30 seconds.Cu Reagent808080Cap the tubes tightly and vortex at medium speed for 30 seconds. Incubate at room temperature (25°C) for 20 minutes. Centrifuge at 2,000 g, room temperature (25°C) for 5 minutes.Upper Phase505050Chromogen2002002004.3 Incubate at room temperature (25°C) for 5 minutes. Transfer 200 µL from each tube to the corresponding wells of a 96-well plate or micro glass cuvettes. Measure the absorbance at 550 nm.Calculate ΔAtest=Atest-Ablank and ΔAstd=Astd-Ablank (The blank tube only needs to be set up once).Note: The measurement must be completed within 30 minutes after color development. It is recommended to perform preliminary experiments with 2-3 samples expected to have significant differences before formal testing. If Atest exceeds the detection range of the instrument, dilute the sample further with Extraction Buffer and multiply the result by the dilution factor.5. Result CalculationWe provide both derived and simplified calculation formulas, which are equivalent. The simplified formulas in bold are recommended as the final calculation formulas.5.1 Standard Curve PlottingPlot the standard curve with standard concentration as the y-axis and ΔAstd as the x-axis (using concentration as the y-axis facilitates calculation). Substitute ΔAtest into the standard curve equation to obtain y (mM).5.2 Sample FFA Content Calculation(1) Based on sample mass:FFA Content (µmol/g fresh weight) = y × Vextract ÷ W × n = y ÷ W × n(2) Based on bacterial or cell count:FFA Content (µmol/10⁴ cells) = y ÷ (Cell or Bacterial Count ÷ Vextract ) × n = y ÷ 500 × n = 0.002 × y × n(3) Based on liquid volume:FFA Content (µmol/L) = 1000 × y × nParameter Description:Vextract : Volume of Extraction Buffer added, 1 mLW: Sample mass, gn: Sample dilution factor (if further diluted)500: Cell or bacterial count, in units of 10⁴1000: Unit conversion factor, 1 L = 1000 mL6. Result PresentationTypical Standard Curve: y = 0.679x - 0.0109, R² = 0.9988(Free Fatty Acid (FFA) standard curve analyzed using a 96-well plate. Data and curve are for reference only; users must establish their own standard curve based on their experiment.)Precautions1. Biochemical reagents are generally irritating and biologically toxic. For your safety and health, please implement appropriate biosafety precautions throughout the experiment. Wear personal protective equipment such as lab coats, masks, gloves, and hair caps. Perform experiments in a fume hood or biosafety cabinet.2. This product is for scientific research use only. Not intended for clinical diagnosis... Read More | D-Lactate, typically present in the bloodstream at nanomolar concentrations, is produced by an intestinal source or via the methylglyoxal pathway. In mammals, D-Lactate metabolism requires D-Lactate hydrogenase and is metabolized slowly, thus an increase in blood concentration levels can lead to D-Lactate, typically present in the bloodstream at nanomolar concentrations, is produced by an intestinal source or via the methylglyoxal pathway. In mammals, D-Lactate metabolism requires D-Lactate hydrogenase and is metabolized slowly, thus an increase in blood concentration levels can lead to acidemia and acidosis. The severity of this D-lactic acidosis can be associated with neurotoxic symptoms. Significant D-Lactate accumulations in the body can also be related to impaired metabolism and excretion.D-Lactate Colorimetric Assay kit has been used to determine the stereospecificity of lactate produced.Suitability: Suitable for use with samples of serum, plasma, cells, culture and fermentation media.Principle: In this assay, D-Lactate is specifically oxidized by D-Lactate hydrogenase and generates a proportional colorimetric product measured at 450 nm. The useful concentration range in samples is 0.1-10 mM D-Lactate... Read More | Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize matrix effects, cross-reactions and unspecific binding in immunoassays like ELISA, Western blotting, Immunohistochemistry, protein arrays and immuno-PCR.The Effect Diluents, Animal-free are used alternatively to the standard sample or antibody dilution buffers: In ELISA for the dilution of specimen and detection antibodies. In Western Blotting for the dilution of primary and secondary antibodies. In Protein arrays for the dilution of specimen and detection antibodies. In immuno-PCR as a washing buffer.Three versions of the diluent are offered: Low, Medium and High for optimal discrimination between specific and unspecific reaction and for minimizing strong interference effects e.g., by RF (rheumatoid factors), HAMAs (human-a-mouse Abs) or by endogenous components that bind and mask the analyte.Composition & Properties The Effect Diluents, Animal free contain no animal components and are free of phosphates.Working Procedure 1.Mix thoroughly prior to use. 2.Dilution recommendations a.Dilute antibodies according to the instruction of the antibody b.Dilution of the specimen is recommended at 1:2 or higherTips & TricksEffect Diluents must not be considered as blocking buffers. Recommended blocking buffers are: Synthetic Blocking Buffer, ELISA (cat. no. S494401), Synthetic Blocking Buffer, Blotting (cat. no. S494457) and WellChampion (cat. no. W494467) for plate blocking and stabilization (preparation of pre-coated plates). Complex sample matrices, such as serum and plasma, may contain interfering factors that affect the ability of the assay to accurately quantify the target analyte. Strong interferences are often caused by RFs and HAMAs. This matrix effect can cause high background in the negative control or false negatives in the sample measurement. To reduce this effect the samples can be diluted in the Effect Diluents, Animalfree.Handling & Storage Store solution 2-8°C or -15 to -30°C (tolerates freezing and thawing cycles)... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |