| Description | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL RT R669988G RNase-Free Water 10 mL RT R669988H Spin Columns FL with Collection Tubes 50 sets RT R669988I Spin Columns RM with Collection Tubes 50 sets RT R669988J RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RTProductsThis kit is used for the extraction and purification of high-quality total RNA from a variety of plants, and is also suitable for the extraction of fungal mycelial RNA. The unique separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while the silicon matrix membrane is used to adsorb the RNA for purification, so that various contaminants, such as polysaccharides, are effectively removed by washing, and the eluted RNA can be directly used in various downstream experiments. The molecular weight of RNA extracted by this kit is more than 200 bases, with high purity and almost no DNA residue. For RNA experiments that are very sensitive to trace DNA, the residual DNA can be removed by digestion on a column using RNase-free DNase. The extracted RNA can be used in Northern Blot, Dot Blot, RT-PCR and in vitro translation experiments.Self-contained reagents: β-mercaptoethanol, anhydrous ethanol (freshly opened or for RNA extraction).Pre-experiment Preparation and Important Notes1. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.2) RNase-free water should be used to prepare the solution.(3) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.2. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.(2) Glassware should be dry-roasted at 180°C for 4 hours before use, and plasticware can be soaked in 0.5M NaOH for 10 minutes, rinsed thoroughly with water and autoclaved.3) RNase-free water should be used to prepare the solution.(4) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.3. Avoid repeated freezing and thawing of the extracted samples, otherwise it will affect the amount and quality of RNA extraction.4. Please add β-mercaptoethanol to Buffer RL before use, add 10µl of β-mercaptoethanol to 1ml of Buffer RL, it can be stored for 1 month at room temperature. Buffer RL with β-mercaptoethanol can be stored at room temperature for 1 month. β-mercaptoethanol is not required for use of Buffer RLC.5. Anhydrous ethanol should be added to Buffer RW2 before first use according to the instructions on the reagent bottle label.6. If precipitation occurs in Buffer RL and Buffer RLC, heat to dissolve and leave at room temperature.7. All centrifugation steps are carried out at room temperature and all steps are performed quickly. Procedure1. 50-100 mg of plant tissue is quickly ground to a powder in liquid nitrogen and added to 600 µl of Buffer RL (check for addition of β-mercaptoethanol before use) or Buffer RLC. vortexing and oscillating to allow for adequate lysis.Note: 1) The main component of Buffer RL is guanidine isothiocyanate, which is suitable for lysis of most plant tissues. However, in some plant tissues (e.g. endosperm of corn), due to the special secondary metabolites, guanidine isothiocyanate causes precipitation of the sample, resulting in poor RNA extraction, in this case, Buffer RLC can be added instead of Buffer RL.2) Incubation at 56°C for 1-3 minutes helps tissue lysis, but do not incubate at high temperatures for plants with high starch content.2. Transfer all the liquid obtained in step 1 to an adsorption column (Spin Columns FL) that has been loaded into a collection tube, centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, and transfer the supernatant from the collection tube to a new centrifuge tube (supplied).Note: 1) The tip of the tip of the gun can be cut off when aspirating liquids to facilitate sampling.2) Spin Columns FL removes most of the debris, but a small portion will still flow out and a precipitate will form in the collection tube after centrifugation, so be careful to avoid aspirating the precipitate when proceeding to the next step.3. Add 0.5 times the volume of anhydrous ethanol to the clean lysate obtained in step 2 and mix rapidly.Note: Precipitation may occur upon addition of ethanol, but does not affect subsequent tests.4. Transfer the solution obtained in the previous step to the Spin Columns RM in the collection tube. If it is not possible to add all of the solution to the column at one time, centrifuge the column at 12,000 rpm for 15 seconds in two batches, discard the waste solution and put the column back into the collection tube.5. Add 350 µl Buffer RW1 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid and put the adsorbent column back into the collection tube.6. Preparation of DNase I mixture: Take 52µl of RNase-Free Water, add 8µl of 10×Reaction Buffer and 20µl of DNase I (1U/µl) to it, mix well, and make a final volume of 80µl of reaction solution.7. Add 80µl of DNase I mixture directly to the adsorption column and incubate at 20-30°C for 15 minutes.8. Add 350 µl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid and put the column back into the collection tube.9. Add 500 µl of Buffer RW2 to the column (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 15 seconds, and discard the waste solution.10. Repeat step 9.11. Place the adsorbent column back into the collection tube, centrifuge at 12,000 rpm for 1 minute, and allow the column to come to room temperature for a few minutes to thoroughly dry out the anhydrous ethanol in the adsorbent column.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (zymography, PCR, etc.).12. Load the adsorption column into a new centrifuge tube, add 30-50 µl of RNase-Free Water to the middle of the adsorbent membrane, leave it at room temperature for 1 minute, centrifuge at 12,000 rpm for 1 minute, and store the resulting RNA solution at -70°C to prevent degradation.Note: 1) The volume of RNase-Free Water should not be less than 30 µl, too small volume affects the recovery rate.2) If you want to increase the RNA yield, repeat step 12 with 30-50 µl of fresh RNase-Free Water.3) If the RNA concentration is to be increased, the resulting solution can be reintroduced into the adsorption column and step 12 repeated... Read More | Products contentProducts IntroductionThe Single Cell Whole Genome Amplification Kit can be used as a template for whole genome amplification of single cells or micro samples. The total time for single-cell amplification is about 3 hours, and 2-5 µg of genomic DNA, with a size of 200-1500 bp, Products contentProducts IntroductionThe Single Cell Whole Genome Amplification Kit can be used as a template for whole genome amplification of single cells or micro samples. The total time for single-cell amplification is about 3 hours, and 2-5 µg of genomic DNA, with a size of 200-1500 bp, can be obtained after lysis, pre-amplification and amplification. The amplified product can be widely used in second-generation sequencing, large fragment copy number variation analysis, SNP typing, qPCR analysis and gene chip analysis.Bring your own instruments and reagentsPCR instrument Reaction tubes: low adsorption tubes recommended Gun Heads: High quality filtered gun heads are recommended Microcentrifuge, vortex mixercaveat The sensitivity of this product is very high, the experimental operation should be completed in a positive pressure ultra-clean bench or clean environment, the concentration of the amplification reaction products is high, should be well isolated to avoid aerosol contamination caused by amplification products.Operation flow diagramprocedurePre-experiment preparationSingle cells were obtained by flow cytometry sorting, buffer dilution, micromanipulation and laser microdissection. It is recommended that the cells be washed prior to the experiments with a 1× PBS solution free of Mg2+ and Ca2+, taking care to ensure that the volume of PBS solution in subsequent experiments does not exceed 2 µl. take note of Since the whole experiment is carried out in the same PCR tube and the reaction volume is small, the pipette tip should not touch the liquid in the tube when adding liquid, so as to avoid taking single cells or DNA out of the reaction system; when pipetting, please add the liquid along the wall of the tube carefully and do not blow the liquid in the PCR tube; before the reaction, please centrifuge briefly to make sure that the liquid in the reaction system is mixed evenly. Thaw the cell lysate, pre-amplifier and amplifier on ice before use.cell lysis 1)Mix Cell Lysis Buffer and Cell Lysis Enzyme according to the number of reactions N, shake to mix, centrifuge briefly and set aside.2)Mix single cells with the cell lysis mix in a PCR tube and run the following program.2. Pre-amplification reaction1)Mix Cell Lysis Buffer and Cell Lysis Enzyme according to the number of reactions N, shake to mix, centrifuge briefly and set aside.2)Add 5 µl of pre-amplification mix to 10 µl of lysis reaction product from the previous step and run the following program. 3. Amplification reaction1)Mix Amplification Buffer and Amp Enzyme Mix according to the number of reactions N, mix with shaking, centrifuge briefly and set aside.2)Add 60 µl of amplification mix to 15 µl of pre-amplification reaction product from the previous step and run the following program.Note: The number of cycles can be adjusted as needed, 14 cycles are recommended for single cells obtained by flow sorting, etc.Amplification product detection 1. Agarose gel electrophoresis 5 µl of the amplified product was subjected to agarose gel electrophoresis (1% agarose gel, 110 V, 25-35 min), and the amplified product was 200-1500 bp in size. 2. Quantitative Amplification products were subjected to magnetic bead or column purification, and purified products were quantified using Qubit with a final yield of 2-5 µg... Read More | Cell viability and cytotoxicity assays are usually used for drug screening and compound cytotoxicity testing. The CCK-8 kit uses highly water-soluble tetrazolium salt ( called WST-8 ) to produce water-soluble WST-8 for cell proliferation and cytotoxicity assays. Unlike MTT, WST-8 and WST-8 have no Cell viability and cytotoxicity assays are usually used for drug screening and compound cytotoxicity testing. The CCK-8 kit uses highly water-soluble tetrazolium salt ( called WST-8 ) to produce water-soluble WST-8 for cell proliferation and cytotoxicity assays. Unlike MTT, WST-8 and WST-8 have no cytotoxicity in cell culture medium, so multiple downstream experiments can be performed using the same detection plate. CCK-8 method is a convenient colorimetric method for the determination of cell viability. It does not need the solubilization process and only needs the least steps to provide the results. The CCK-8 method can be used for the determination of 96-well microplates and high-throughput screening of 384-well microplates. Advantage:At present, the commercially available liquid CCK-8 kits generally have defects such as harsh storage conditions ( -4C or -20 ), unstable use in different pH ranges, and easy deterioration ( discoloration or precipitation ). The solid instant CCK-8 kit adopts a new formula and Swiss process, which overcomes these shortcomings of the liquid CCK-8 kit. It can be stored at room temperature for a long time ( > 3 years ), ready to use, stable in a wide pH range, and the experimental results are more reliable. Compared with the liquid CCK-8 kit, the solid-soluble CCK-8 kit has higher sensitivity and the biological response time is shortened by half.Application scope:It can be used for drug screening, cell proliferation assay, cytotoxicity assay, tumor drug sensitivity test and activity detection of biological factors. Operating instructions:This reagent kit can be used for drug screening, cell proliferation assay, cytotoxicity assay, tumor drug sensitivity assay, and activity detection of biological factors.1. Carefully and slowly tear along the gap in the packaging bag;2. Pour all the powder in the bag into a clean container containing 10mL of ultrapure water, shake continuously for 1 minute, and use it when the solid is completely dissolved;3. Unused reagents must be stored at low temperatures below 4 ℃.Equipment required for testing:Enzyme reader 96 well plate with 450-490 nm filter;Carbon dioxide incubator;96 well plate, sterilized transparent plate for cell detection;Multi channel pipette (8 or 12 channels: 10-100 µ l);Blood cell counter or cell counter.Cell viability testing:1. Inoculate cell suspension (100 µ l/well) into a 96 well plate and pre culture the plate in a carbon dioxide incubator for 24 hours (37 ℃, 5% CO2);2. Add 10 µ l of CCK-8 solution to each well (be careful not to generate bubbles in the well as it may affect the reading of OD value);3. Incubate the culture plate in the incubator for 1-4 hours;4. Measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader;5. If the OD value is not determined temporarily, 10 µ l of 0.1M HCI solution or 1% w/v SDS solution can be added to each well, and the culture plate can be covered and stored in the dark at room temperature. Within 24 hours of measurement, the absorbance will not change.Cell proliferation toxicity testing:1. Inoculate cell suspension (100 µ l/well) into a 96 well plate and pre culture the plate in an incubator for 24 hours (37 ℃, 5% CO2);2. Add 10ul of different concentrations of the substance to be tested to the culture plate;3. Incubate the culture plate in the incubator for an appropriate period of time (e.g. 6, 12, 24, or 48 hours);4. Add 10 µ l of CCK-8 solution to each well (be careful not to generate bubbles in the well as they may affect the reading of the OD value);5. Incubate the culture plate in the incubator for 1-4 hours;6. Measure the absorbance at 450nm using an enzyme-linked immunosorbent assay (ELISA) reader;7. If the OD value is not determined temporarily, 10 µ l of 0.1M HCI solution or 1% w/v SDS solution can be added to each well, and the culture plate can be covered and stored in the dark at room temperature. Within 24 hours of measurement, the absorbance will not change.Calculation method for cell survival rate/inhibition rate:Cell survival rate=[As Ab)/(Ac Ab)] x 100%Inhibition rate=[(Ac As)/(Ac Ab)] x 100%As: absorbance of experimental wells (including cells, culture medium, CCK-8 solution, and drug solution);Ac: absorbance of control wells (including cells, culture medium, CCK-8 solution, without drugs);Ab: Blank well absorbance (including culture medium and CCK-8 solution, excluding cells and drugs).Points for attention: 1.Unused reagents must be stored at low temperature below 4 °C, and stored in the dark at-20 °C for two years after unpacking, so as to avoid repeated thawing ; 2.The culture time of CCK-8 is generally 1-4 hours, but the naked eye can be taken out to observe the color degree in about 30 minutes. According to the cell type, the conditions need to be explored. The best reaction time of CCK-8 is based on the best time of specific color development.3. It is recommended to do a few holes to explore the number of inoculated cells and the culture time after adding CCK-8 reagent ; 3.The WST-8 in this kit will react with reducing agents ( such as some antioxidants ) to interfere with the detection. Before the cell proliferation-toxicity test, the background OD can be checked to confirm whether there is a reducing agent in the substance to be tested. If the effect of reducing agent needs to be removed, the fresh medium can be replaced before adding CCK-8 ( remove the medium, wash the cells twice with the medium, and then add the new medium ) ; 4.Phenol red in the medium does not affect the experimental results, and the absorbance of phenol red can be eliminated by deducting the absorbance of the background in the blank hole during calculation, so it will not affect the detection. 5.It is recommended to use a multi-channel pipette to reduce the difference between parallel holes. When adding CCK-8 reagent, it is recommended to add it obliquely to the wall of the culture plate, not to insert it under the liquid surface of the medium, which is easy to produce bubbles and interfere with OD determination. 6.If the drug contains metal, it has an effect on the color of CCK-8. The final concentration of 1mM lead chloride, ferric chloride and copper sulfate will inhibit the color reaction of 5 %, 15 % and 90 %, and reduce the sensitivity. If the final concentration is 10mM, the color reaction will be 100 % inhibited ; 7.When using a 96-well plate for detection, if the cell culture time is long, attention should be paid to the evaporation problem. On the one hand, because a circle around the 96-well plate is the easiest to evaporate, the method of discarding the surrounding circle can be adopted, and the same amount of PBS, water or culture medium can be added. On the other hand, the 96-well plate can be placed near the water source in the incubator to alleviate evaporation ; 8.When using standard 96-well plates, the minimum inoculation amount of adherent cells is at least 1,000 cells / well ( 100µl medium ). The sensitivity of detecting white blood cells is relatively low, so it is recommended that the inoculation amount should not be less than 2,500 cells / well ( 100 µl medium ). If you want to use a 24-well plate or a 6-well plate experiment, first calculate the corresponding inoculation amount per well, and add the CCK-8 solution according to 10 % of the total volume of the medium per well ; 9.Cell culture time varies according to the type and number of cells ( per well ), usually the color of white blood cells is weak, requiring a longer culture time ( 4 hours ) and a large number of cells ( ~ 105 cells / well ) ; 10.CCK-8 reagent is very low toxic to cells. The continuous reaction between it and dehydrogenase in living cells makes the color of the solution deepen and the OD value increase. The following methods can terminate the CCK-8 reaction ( 96-well plate ) : a ) After the color reaction, the culture plate was placed in a refrigerator at 4 ° C ; b ) 10µL 0.1MHCL solution was added to each well ; c ) 10 µL 1 % ( w / v ) SDS ( sodium dodecyl sulfate ) solution was added to each well. After the reaction stopped, the OD value should be measured within 24 hours. 11.To determine the specific number of cells, it is recommended to do the standard curve at the same time... Read More |