| Description | Product Introduction:Blood samples are an important source of biological information in clinical research. They contain circulating proteins from multiple tissues and organs, which are involved in a wide range of biological processes and can be used as biomarkers or drug targets. However, blood Product Introduction:Blood samples are an important source of biological information in clinical research. They contain circulating proteins from multiple tissues and organs, which are involved in a wide range of biological processes and can be used as biomarkers or drug targets. However, blood samples have problems such as complex types of proteins, a large dynamic range, and a high proportion of high-abundance proteins, which bring great difficulties to proteome detection. This kit enriches circulating proteins in plasma samples based on the immunomagnetic bead capture method. In downstream proteomics detection, it can reduce the coverage of low-abundance protein signals by high-abundance proteins, thereby increasing the signal intensity of low-abundance proteins and improving the number of identified proteins and the repeatability of quantification.Product Components and Storage Conditions:M1456358Component12T24T48TStorageM1456358AMagnetic beads Max225 µL450 µL900 µL4℃M1456358BIncubation Buffer I6.25 mL12.5 mL25 mLRTM1456358CIncubation Buffer II7.5 mL15 mL30 mLRTM1456358DWashing Buffer7.5 mL15 mL30 mLRTOperating Procedure:1.Centrifuge the plasma sample (3000g, 10min), and take the supernatant for later use (if storage is needed, store it at -80°C for long-term preservation to avoid repeated freezing and thawing).2.Take 50-100µL of centrifuged plasma, add 400µL of Incubation buffer I, then add 18µL of Magnetic beads, vortex to mix, and incubate at room temperature on a shaking mixer for 1h.3.After incubation, use a magnetic rack to magnetically attract for 3min, and discard the supernatant.4.Remove the EP tube, add 500µL of Incubation buffer II, gently invert up and down to mix several times, magnetically attract for 3min, and discard the supernatant.5.Remove the EP tube, add 500µL of Washing Buffer, gently invert up and down to mix several times, magnetically attract for 3min, and discard the supernatant.6.Add 50µL of Protein Lysis Buffer (P1408622) to the beads obtained in step 5.7.It can be processed according to the conventional proteomics pretreatment steps in the laboratory, or our Proteomics Pretreatment Kit (P1456469) (to be purchased separately) can be used for processing.Precautions:1.Magnetic beads will precipitate after standing. Please shake gently and thoroughly before each use to keep the magnetic beads in a uniform suspension state.2.During the storage and use of magnetic beads, operations such as freezing, drying and high-speed centrifugation should be avoided, as they may damage the structure of magnetic beads and affect their protein-binding ability.3.This product is limited to scientific research use by professionals, and must not be used for clinical diagnosis or treatment, nor for food or drugs... Read More | Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm.Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm. In the early stage of apoptosis, different types of cells will turn phosphatidylserine out to the cell surface and expose to the extracellular environment. At this time, using Annexin V labeled with fluorescent protein PE, that is, Annexin V-PE, combined with phosphatidylserine ( PS ), the eversion of phosphatidylserine, an important feature of apoptosis, can be directly detected by flow cytometry. Normal cells will not be stained by Annexin V-PE, apoptotic or necrotic cells will be stained by Annexin V-PE. Annexin V-PE can be used in combination with partially non-permeable nuclear dye ( 7-AAD / PI ) to distinguish cells at different stages of apoptosis. RedNucleus II provided in this kit is a far-red dye that belongs to an anthraquinone compound and cannot penetrate the intact cell membrane of living cells and early apoptotic cells. It is non-permeable, but can quickly stain the nucleus / dsDNA in dead and permeable cells. RedNucleus II is an ideal substitute for propidium iodide ( PI ) and 7-AAD.Combined with Annexin V-PE, it has better spectral characteristics without compensation regulation : it is not excited by ultraviolet light and does not overlap with PE / PE homologues, so it can be combined with FITC, PE and purple fluorescent dyes for multicolor analysis. When combined with Annexin V-PE, RedNucleus II was excluded from living cells and early apoptotic cells, while late apoptotic cells and dead cells were double-positive for Annexin V-PE and RedNucleus II. Annexin V-PE / RedNucleus II apoptosis detection kit can be detected by flow cytometry or other fluorescence detection equipment. Components: Components A598354(10T) A598354(50T) A598354(100T) A. 1×Annexin V Combining buffer solution 10 mL 50 mL 50 mL×2 B. Annexin V-PE 50 µL 250 µL 500 µL C. RedNucleus II 100 µL 500 µL 1 mLProduct parameters：Annexin v-pe:ex/em=488/578 nmrednucleus ii:ex/em=635/695 NMUsage method:1. Experimental design: Blank tube: Negative control group cells, without Annexin V-PE/RedNucleus II. Used to regulate voltage.Single staining tube: Positive control group cells were treated with Annexin V-PE alone/RedNucleus II alone. Used for adjusting compensation.Detection tube: Add Annexin V-PE/RedNucleus II to the processed cells. After adjusting the voltage compensation using blank tubes and single dye tubes, obtain the required flow data.2. Collect cells(1) For suspended cells:a. After inducing cell apoptosis, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS, and count them.Note: PBS resuspension cannot be omitted. The process of PBS resuspension also serves to wash cells, ensuring the subsequent binding of Annexin V-PE.b. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. c. Add 5 µ L Annexin V-PE and mix gently.d. Add 5 µ L of RedNucleus II staining solution and mix gently.e. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.(2) For adherent cells:a. Suck out the cell culture medium into a suitable centrifuge tube, wash the adherent cells with PBS once, and add an appropriate amount of trypsin cell digestion solution (without EDTA) to digest the cells. Incubate at room temperature until gently blowing can remove the trypsin cell digestion solution when the adherent cells are blown down. Overdigestion of pancreatic enzymes should be avoided.Note: For adherent cells, the trypsin digestion step is crucial. If the trypsin digestion time is too short, cells need to be blown hard to detach, which can easily cause damage to the cell membrane and lead to false positives of cell necrosis; If the digestion time is too long, it can also cause cell membrane damage and false positives of cell necrosis, and even affect the binding of phosphatidylserine and Annexin V-PE on the cell membrane, thereby interfering with the detection of cell apoptosis.b. Add the cell culture medium collected in the previous step, gently blow down the cells, transfer them to a centrifuge tube, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS and count them.Note: Adding the cell culture medium from the previous step is very important. On the one hand, it can collect cells that have already been suspended and undergone apoptosis or necrosis. On the other hand, the serum in the cell culture medium can effectively inhibit or neutralize residual trypsin. The residual trypsin will digest and degrade the subsequently added Annexin V-PE, leading to staining failure.c. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. d. Add 5 µ L Annexin V-PE and mix gently.e. Add 5 µ L of RedNucleus II staining solution and mix gently.f. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.3. Result analysis:(1) Flow cytometry detection:a. After incubation, 400 µ L of 1 × Annexin V binding buffer can be directly added to resuspend the cells, and immediately detected on the machine. Annexin V-PE is excited by 488 nm/566 nm laser, and the fluorescence emission spectrum is detected at 578 nm (BL2 (FL2)/YL1 channel), while the RedNucleus II channel emission spectrum is approximately at 695 nm (RL1 (FL4) channel).b. On the scatter plot of the bivariate flow cytometer, live cells are shown in the lower left quadrant, which is (Annexin V-PE -/RedNucleus II -); The lower right quadrant represents early apoptotic cells, which are (Annexin V-PE+/RedNucleus II -); The upper right quadrant represents necrotic and late stage apoptotic cells, which are (Annexin V-PE+/RedNucleus II+); The upper left quadrant displays naked nuclear cells, which are (Annexin V-PE -/RedNucleus II+).(2) Fluorescence microscopy detection:a. Centrifuge at 1000 rpm for 5 minutes, collect cells, and gently resuspend them in 400 µ L of 1 × Annexin V binding buffer. Transfer the cells to a 96 well plate and settle for a moment or perform cell smear, then observe under a fluorescence microscope.b. Annexin V-PE is compatible with PE filters. RedNucleus II can use a far red long pass filter.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. to reduce the process of apoptosis, the incubation process can be operated on ice, but the incubation time should be extended to at least 30 min. 3. as apoptosis is a rapid process, it is recommended that samples be analyzed within 1 h after staining. 4. for adherent cells, digestion is a key step. If there are floating cells when adherent cells induce apoptosis, the floating cells and adherent cells should be collected and stained. Handle adherent cells with care to avoid artificial damage to cells. The trypsin digestion time is too short, and the cells need to be blown hard to fall off, which is easy to cause damage to the cell membrane and excessive intake of rednucleus II; If the digestion time is too long, the cell membrane is also prone to damage, and even affect the binding of phosphatidylserine and annexin v-pe on the cell membrane. When digesting, spread pancreatin on the bottom of the well plate, fully contact the pancreatin with the cells when shaking gently, then pour out most of the pancreatin, use the remaining small amount of pancreatin to digest for a period of time, and terminate when the gap between cells increases and the bottom of the bottle is spotted. Try not to use EDTA in the digestive juice, which will affect the binding of annexin V to PS. 5. after the adherent cells are digested with trypsin, it is recommended to stain after recovering in the optimal culture conditions and medium for about 30 min to avoid false positives. 6. in order to avoid losing cells when washing cells, you can use a large tip over a small tip to aspirate. 7. the optimal concentration of dye is determined by the specific experimental requirements. 8. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 9. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Early apoptosis detection, annexin V Kit... Read More | B669951 Component 50T Storage B669951A Buffer ATL 15 mL RT B669951B Buffer AL 15 mL RT B669951C Buffer AW1 (concentrate) 13 mL RT B669951D Buffer AW2 (concentrate) 15 mL RT B669951E Buffer EB 15 mL RT B669951F Proteinase K 1.25 mL RT B669951G Spin Columns DM with Collection Tubes 50 sets B669951 Component 50T Storage B669951A Buffer ATL 15 mL RT B669951B Buffer AL 15 mL RT B669951C Buffer AW1 (concentrate) 13 mL RT B669951D Buffer AW2 (concentrate) 15 mL RT B669951E Buffer EB 15 mL RT B669951F Proteinase K 1.25 mL RT B669951G Spin Columns DM with Collection Tubes 50 sets RTProductsThis kit is suitable for extracting high purity total DNA from Gram-negative and Gram-positive bacteria. 106-108 cells can be processed at a time, and up to 20 µg of total DNA can be obtained within one hour without the need for toxic solvents such as phenol or chloroform, and without the need for ethanol precipitation. The optimized buffer system enables the DNA in the lysate to be efficiently and specifically bound to the silica matrix centrifugal adsorption column, while other contaminants can flow through the membrane, and the inhibitors of PCR and other enzymatic reactions can be effectively removed through a two-step washing step, and finally washed off with low-salt buffer or water, so that high-purity DNA can be obtained.The purified DNA can be used for downstream experiments such as digestion, PCR, Real-Time PCR, library construction, Southern Blot and molecular labeling, molecular labeling and other downstream experiments. Self-contained reagents: anhydrous ethanol; Enzymatic Lysis Buffer is required for extraction of Gram-positive bacteria.Enzymatic Lysis Buffer was prepared by 20 mM Tris, pH 8.0; 2 mM Na2-EDTA, pH 8.0; and 1.2% Triton X-100. 121°C sterilization for 20 minutes, and the appropriate amount of Lysozyme was added at a final concentration of 20 mg/ml. Pre-experiment Preparation and Important Notes1. Add 1.25ml Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time, and avoid repeated freezing and thawing to avoid affecting its activity.2. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller DNA fragments and a decrease in the amount of extracted DNA.3. If extracting genomes from bacterial cultures with high accumulation of secondary metabolites or thick cell walls, it is recommended that samples be collected early in the logarithmic phase.4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the label of the reagent bottle before first use.5. Before use, please check Buffer GTL and Buffer GL for crystallization or precipitation. If crystallization or precipitation occurs, please re-dissolve Buffer GL and Buffer GTL in a 56℃ water bath.6. If the downstream experiments are sensitive to RNA contamination, 4µl of DNase-Free RNase A (100mg/ml) can be added before adding Buffer GL. RNase A is not provided in this kit.If the extracted samples are Gram-positive bacteria, customers need to prepare their own Enzymatic Lysis Buffer to treat the bacteria, which requires the use of Lysozyme (lysozyme) at a concentration of 20 mg/ml, which is not provided in this kit.Procedurei Extraction of genomic DNA from Gram-negative bacteria1. Take 1-5 ml of bacterial culture (106-108 cells, maximum 2×109 cells) and put it into a centrifuge tube (provided), centrifuge it at 12,000 rpm (~13,400×g) for 1 minute, and aspirate the supernatant as much as possible.2. Add 180 µl Buffer GTL to the precipitate and shake to resuspend the bacteria.3. Add 20 µl of Proteinase K, vortex and mix well, incubate at 56°C until the solution becomes clear, and invert or shake the centrifuge tube at intervals during the incubation to disperse the sample.Note: If RNA removal is required, add 4 µl of RNase A solution at a concentration of 100 mg/ml after the above steps are completed, shake to mix, and leave for 5-10 minutes at room temperature.4. Add 200µl Buffer GL and mix well with vortexing and shaking. Add 200µl of anhydrous ethanol and mix well with vortexing and shaking.Centrifuge briefly so that the solution on the walls of the tube collects at the bottom.Note: 1) If multiple samples are manipulated together, Buffer GL and anhydrous ethanol can be mixed in equal proportions and then added together, shaking to mix.2) The addition of Buffer GL and anhydrous ethanol may produce a white precipitate that will not affect subsequent experiments.5. Add all of the solution obtained in step 4 (including the precipitate formed) to the Spin Columns DM in the collection tube, or if the solution cannot be added all at once, transfer it several times. centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and return the column to the collection tube.6. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and return the adsorption column to the collection tube.7. Add 500 µl of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 7 can be repeated if further DNA purity is required.8. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorbent column at room temperature for several minutes to dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorbent column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).9. Place the adsorption column in a new centrifuge tube, add 50-200 µl Buffer GE to the middle part of the adsorption column overhanging the center of the adsorption column, leave it at room temperature for 2-5 minutes, centrifuge it at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20 ℃. note: 1) If the downstream experiments are sensitive to the pH or EDTA, the elution can be done with sterilized water. The pH of the elution solution has a great influence on the elution efficiency. If water is used as the elution solution it should be ensured that its pH is 7.0-8.5 (the pH of water can be adjusted to this range with NaOH), and the elution efficiency is not high when the pH is lower than 7.0.2) Incubation at room temperature for 5 minutes prior to centrifugation increases yield.3) Re-elution with an additional 50-200 µl Buffer GE or sterilized water can increase the yield.4) If the final concentration of DNA is to be increased, the DNA eluate obtained in step 9 can be re-spiked onto the adsorbent membrane and step 9 repeated; if the elution volume is less than 200 µl, the final concentration of DNA can be increased, but the total yield may be reduced. If the amount of DNA is less than 1 µg, elution with 50 µl Buffer GE or sterilized water is recommended.(5) DNA stored in water will be affected by acidic hydrolysis. For long-term storage, it is recommended to elute with Buffer GE and store at -20℃.i. Extraction of genomic DNA from Gram-positive bacteria1. Take 1-5 ml of bacterial culture (106-108 cells, maximum 2×109 cells) and put it into a centrifuge tube (provided), centrifuge it at 12,000 rpm (~13,400×g) for 1 minute, and aspirate the supernatant as much as possible.2. Add 180µl Enzymatic Lysis Buffer (self-provided) to resuspend the bacteria.Enzymatic Lysis Buffer is prepared as described in the Self-Prepared Reagents section in the front of the manual.3. Incubate at 37°C for 30 minutes.4. Add 20µl Proteinase K and mix well. Add 200µl of Buffer GL and mix well with vortexing and shaking.Note: Do not add Proteinase K directly to Buffer GL.Incubate at 5.56°C for 30 minutes.Note: 1) If desired, incubation at 95°C for 15 minutes will inactivate the pathogen, but 95°C incubation will cause some DNA degradation.(2) If RNA removal is required, add 4µl of RNase A solution at a concentration of 100mg/ml after the above steps are completed, shake and mix well, and leave for 5-10 minutes at room temperature.6. Add 200µl of anhydrous ethanol and mix well with vortex shaking.Note: The addition of anhydrous ethanol may produce a white precipitate that will not affect subsequent experiments.7. Add all of the solution obtained in step 6 (including the precipitate formed) to the Spin Columns DM that have been loaded into the collection tube, and if the solution cannot be added all at once, it can be transferred in several times. centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid from the collection tube, and put the column back into the collection tube.8. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.9. Add 500 µl Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge the column at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the column back into the collection tube.Note: Step 9 can be repeated if further DNA purity is required.10. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).11. Place the adsorption column in a new centrifuge tube (self-provided), add 50-200 µl of Buffer GE to the center of the adsorption column overhanging the center of the adsorption column, let it stand at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20℃.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on the elution efficiency, if water is used as the eluent should ensure that its pH is 7.0-8.5 (you can use NaOH to adjust the pH of the water to this range), and the elution efficiency is not high when the pH is lower than 7.0.2) Incubation at room temperature for 5 minutes prior to centrifugation increases yield.3) Re-elution with an additional 50-200 µl Buffer GE or sterilized water can increase the yield.4) If the final concentration of DNA is to be increased, the DNA eluate obtained in step 11 can be re-spiked onto the adsorbent membrane and step 11 repeated; if the elution volume is less than 200 µl, the final concentration of DNA can be increased, but the total yield may be reduced. If the amount of DNA is less than 1 µg, elution with 50 µl Buffer GE or sterilized water is recommended.(5) DNA stored in water will be affected by acidic hydrolysis. For long-term storage, it is recommended to elute with Buffer GE and store at -20℃... Read More | Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize matrix effects, cross-reactions and unspecific binding in immunoassays like ELISA, Western blotting, Immunohistochemistry, protein arrays and immuno-PCR.The Effect Diluents, Animal-free are used alternatively to the standard sample or antibody dilution buffers: In ELISA for the dilution of specimen and detection antibodies. In Western Blotting for the dilution of primary and secondary antibodies. In Protein arrays for the dilution of specimen and detection antibodies. In immuno-PCR as a washing buffer.Three versions of the diluent are offered: Low, Medium and High for optimal discrimination between specific and unspecific reaction and for minimizing strong interference effects e.g., by RF (rheumatoid factors), HAMAs (human-a-mouse Abs) or by endogenous components that bind and mask the analyte.Composition & Properties The Effect Diluents, Animal free contain no animal components and are free of phosphates.Working Procedure 1.Mix thoroughly prior to use. 2.Dilution recommendations a.Dilute antibodies according to the instruction of the antibody b.Dilution of the specimen is recommended at 1:2 or higherTips & TricksEffect Diluents must not be considered as blocking buffers. Recommended blocking buffers are: Synthetic Blocking Buffer, ELISA (cat. no. S494401), Synthetic Blocking Buffer, Blotting (cat. no. S494457) and WellChampion (cat. no. W494467) for plate blocking and stabilization (preparation of pre-coated plates). Complex sample matrices, such as serum and plasma, may contain interfering factors that affect the ability of the assay to accurately quantify the target analyte. Strong interferences are often caused by RFs and HAMAs. This matrix effect can cause high background in the negative control or false negatives in the sample measurement. To reduce this effect the samples can be diluted in the Effect Diluents, Animalfree.Handling & Storage Store solution 2-8°C or -15 to -30°C (tolerates freezing and thawing cycles)... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |