| Description | Inquire | Alanine Aminotransferase (ALT), also known as serum glutamic-pyruvic transaminase (SGPT), is a pyridoxal-phosphate-dependent enzyme that catalyzes the reversible transfer of an amino group from alanine to α-ketoglutarate, generating pyruvate and glutamate. ALT is found primarily in liver and Alanine Aminotransferase (ALT), also known as serum glutamic-pyruvic transaminase (SGPT), is a pyridoxal-phosphate-dependent enzyme that catalyzes the reversible transfer of an amino group from alanine to α-ketoglutarate, generating pyruvate and glutamate. ALT is found primarily in liver and serum, but occurs in other tissues as well. Hepatocellular injury often results in an increase of serum ALT levels and serum ALT levels can be used as a marker for liver injury.ALT Activity Assay kit has been used to determine the activity of alanine aminotransferase (ALT) in serum samples... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This reagent kit is designed based on the principle that biotin and Streptavidin have a strong affinity. After the primary antibody of rabbit or mouse origin binds to the corresponding target antigen, the biotinylated antibody in this kit • • Rabbit/mouse universal secondary antibody This reagent kit is designed based on the principle that biotin and Streptavidin have a strong affinity. After the primary antibody of rabbit or mouse origin binds to the corresponding target antigen, the biotinylated antibody in this kit • • Rabbit/mouse universal secondary antibody specifically binds to the primary antibody; The biotin labeled on the secondary antibody binds to streptavidin labeled with peroxidase (HRP), forming an antigen-specific primary antibody biotinylated secondary antibody streptavidin complex labeled with HRP. HRP can catalyze substrate colorimetry, thereby inferring the presence and distribution of the tested antigen. The biotinylated secondary antibody and SA-HRP used in this reagent kit all adopt optimized labeling and purification techniques, which make their staining more sensitive and have a lower background. They are suitable for detecting formalin fixed paraffin embedded tissue sections, as well as frozen sections, cell slides, freshly prepared blood smears, etc. The rabbit/mouse universal Streptavidin HRP kit is suitable for use with aladdin ready to use or concentrated antibodies. Composition:Note: This reagent kit is only suitable for IHC experiments where the primary antibody is an immune or mouse derived antibodNotes:1. Add 1 drop (approximately 50) to each slice µ l) Calculation: 3ml can make 60 slices, and 18ml can make 360 slices.2.For tissues with abundant endogenous biotin content, it is best to use endogenous biotin blockers for blocking when using this kit.3. DAB working solution is prepared and used immediately, and the prepared working solution is effective within 1 hour in the dark at 2-8 ° C.4. During the experiment, avoid drying the tissue slices, so the amount of working fluid used during each incubation step must be sufficient to ensure complete coverage of the tissue sample, and incubation should be carried out in a wet box as much as possible.5. To obtain the best experimental results, please make sure to optimize the experimental conditions and reagent dosage.6. DAB is a suspected carcinogen, please take necessary protective measures when using it. 7. This product is only for scientific research and cannot be used for human reactions or treatments.Operation steps:1. Routine processing of samples such as paraffin or frozen tissue sections or cell slides to be tested.1) Preparation for staining of tissue sections or cell slides: a. Dewaxing and hydration of paraffin sections: bake at 60 º C for 1 hour, dewaxing twice with xylene for 5 minutes each time; Then immerse in gradient ethanol (anhydrous ethanol anhydrous ethanol 95% 85% 75% ethanol) and distilled water for 5 minutes each for hydration. b. Frozen sections and cell climbing sections (or climbing sections) were soaked in 0.01 M pH 7.4 PBS and washed 3 times for 5 minutes. Then cover the tissue (or cells) with 0.1% Triton X-100 and infiltrate for 15 minutes. Wash twice with 0.01 M pH 7.4 PBS for 5 minutes.2) Antigen repair of paraffin sections: In most cases, high-pressure repair with citric acid buffer is suitable for paraffin tissue sections. Preparation of repair solution: Add 10 ml of citric acid buffer (IHC antigen repair solution, 100 x) to 1 L of deionized water, and mix well. Repair process: The repair solution is added to a high-pressure cooker, and the repaired slices are immersed in the repair solution (must have no tissue). Cover the pressure cooker cover, heat until evenly sprayed with steam, and start timing from the spraying. After 1-2 minutes, the pressure cooker leaves the heat source and cools naturally to room temperature. Remove the slices, rinse with distilled water, and rinse twice with PBS (0.01 M pH 7.4) for 3 minutes each time.2. Add an appropriate amount of Solution A white solution, which is an endogenous peroxidase blocking solution, and incubate at room temperature for 10 minutes, then rinse thoroughly with PBS.3. Add an appropriate amount of Solution B white solution dropwise, which is sealed with normal sheep serum working solution. Incubate at room temperature for 10 minutes and shake dry.4. Add an appropriate amount of primary antibody working solution (commercial ready to use antibodies or concentrated antibodies diluted in appropriate proportions) dropwise, incubate according to experimental requirements, and then rinse thoroughly with PBS.5. Add an appropriate amount of Solution C yellow solution, namely biotin labeled sheep anti rabbit/mouse secondary antibody working solution, incubate at room temperature for 10 minutes, and rinse thoroughly with PBS.6. Add an appropriate amount of Solution D red solution, which is HRP labeled streptavidin. Incubate at room temperature for 10 minutes and rinse thoroughly with PBS.7. Preparation of DAB color working solution: According to the required amount, mix DAB-A and DAB-B in a volume ratio of 1:19 to obtain DAB color working solution. Alternatively, one drop (approximately 50) can be added per milliliter of reagent B µ l) Reagent A, mix well.8. Color development: Add an appropriate amount of DAB color development working solution to the tissue section or cell slide that needs to be developed, and the color development time is generally 1-5 minutes. Observe and control the color development time under a microscope. When the optimal color development effect is achieved, rinse with tap water to terminate the color development. The colored slices are re stained, dehydrated and transparent, and can be stored for a long time after sealing... Read More |