| Description | Acetate Kinase (ACK) is primarily found in microorganisms. It catalyzes the conversion of acetate and ATP to acetyl phosphate and ADP, serving as a key enzyme in bacterial carbon and energy metabolism, and plays a central role particularly in the methanogenesis metabolism of archaea.Assay Acetate Kinase (ACK) is primarily found in microorganisms. It catalyzes the conversion of acetate and ATP to acetyl phosphate and ADP, serving as a key enzyme in bacterial carbon and energy metabolism, and plays a central role particularly in the methanogenesis metabolism of archaea.Assay PrincipleACK catalyzes the synthesis of Acetyl Phosphate and ADP from Sodium Acetate and ATP. Pyruvate Kinase then catalyzes the conversion of ADP and Phosphoenolpyruvate (PEP) to ATP and Pyruvate. Subsequently, Lactate Dehydrogenase catalyzes the reduction of Pyruvate by NADH to produce Lactate and NAD⁺. The rate of oxidation of NADH to NAD⁺, measured by the decrease in absorbance at 340 nm, reflects ACK activity.Component48T96TStorageExtraction Buffer60 mL60 mL×22-8℃ReagentⅠ15 mL30 mL2-8℃ReagentⅡ1EA2EA-20℃. Store in the dark.Reagent III25 µL50 µLNote: It is recommended to perform a pilot experiment with 2-3 samples expected to have significant differences before formal testing.Required Materials and Equipment (Not Provided)Microplate reader or UV spectrophotometer (capable of measuring absorbance at 340 nm)96-well UV plate or micro quartz cuvetteAdjustable pipettes and tipsConstant temperature water bathIce makerCentrifugeDeionized waterHomogenizer (for tissue samples)Reagent PreparationExtraction Buffer: Ready-to-use. Equilibrate to room temperature (RT) before use. Store at 4°C.Caution: Extraction Buffer is toxic and has a pungent odor. It is recommended to handle it within a fume hood.Reagent Ⅰ: Ready-to-use. Equilibrate to RT before use. Store at 4°C.Working Reagent Ⅱ: Prepare immediately before use. For one vial of Reagent Ⅱ, add 11 mL of Reagent Ⅰ and 19.8 µL of Reagent III. Mix thoroughly to dissolve. Prepare fresh for each use. Can be stored protected from light at -20°C for one month.Reagent Ⅲ: Ready-to-use. Equilibrate to RT before use. Store at 4°C protected from light.Sample Preparation*Note: The use of fresh samples is recommended. If not used immediately, samples can be stored at -80°C for up to one month. Control the temperature and time during thawing. If thawed at room temperature, complete the process within 4 hours.*1.Tissues: Weigh approximately 0.1 g of sample. Add 1 mL of Extraction Buffer and homogenize on ice. Centrifuge the homogenate at 15,000 g, 4°C for 10 min. Collect the supernatant and keep it on ice for assay.2.Cells or Bacteria: Collect 5 million cells or bacteria by centrifugation. Wash the pellet with cold PBS, centrifuge, and discard the supernatant. Add 1 mL of Extraction Buffer. Disrupt the cells/bacteria by sonication on ice (200W power, pulse 3s on/10s off, repeat 30 times). Centrifuge the lysate at 15,000 g, 4°C for 10 min. Collect the supernatant and keep it on ice for assay.3.Serum (Plasma) or other liquid samples: Assay directly. If the solution is turbid, centrifuge first and use the supernatant for assay.Note: To determine protein concentration, Aladdin's BCA Protein Quantification Kit (B665595) or Ready-to-Use BCA Protein Quantification Kit (R1491648) is recommended.Assay Procedure1.Preheat the microplate reader or spectrophotometer for 30 min. Set the wavelength to 340 nm. Zero the spectrophotometer with deionized water.2.Pre-warm a sufficient volume of the prepared Working Reagent Ⅱ at 37°C (for mammalian samples) or 25°C (for other species) for 5 minutes. Use immediately.3.Assay Setup (perform in a 96-well UV plate or micro quartz cuvette):ReagentTest Well (µL)Sample20Working Reagent Ⅱ180Mix thoroughly immediately after addition. Measure the absorbance at 340 nm at 10 seconds (A₁) and again at 190 seconds (A₂). Calculate ΔA = A₁ - A₂.Note: It is advised to run a pilot test with 2-3 samples showing expected significant variation beforehand. If ΔA is less than 0.05, consider increasing the sample volume or extending the reaction time to 10 or 20 minutes before measurement. If ΔA is greater than 1.0, dilute the sample further with Extraction Buffer (multiply the result by the dilution factor) or reduce the amount of sample used for extraction.Result CalculationNote: Both the derived and simplified calculation formulas are provided and are equivalent. The simplified formulas (in bold) are recommended for final calculation.1. Calculation for 96-Well UV PlateGeneral Parameters for 96-Well Plate:ε (NADH molar extinction coefficient) = 6.22 × 10³ L/mol/cmd (Light path of 96-well plate) = 0.5 cmVₜₒₜₐₗ (Total reaction volume) = 0.0002 L (200 µL)Vₛₐₘₚₗₑ (Sample volume in reaction) = 0.02 mL (20 µL)T (Reaction time) = 3 minVₛₐₘₚₗₑₜₒₜₐₗ (Total extraction volume) = 1 mLCpr (Sample protein concentration, mg/mL)W (Sample mass, g)500 (Cell/Bacteria count in millions: 5 × 10⁶)1.1 Based on Sample Protein Concentration:Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per mg of protein.Calculation:ACK Activity (U/mg prot) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (Vₛₐₘₚₗₑ × Cpr) ÷ TSimplified Formula: ACK (U/mg prot) = 1072 × ΔA ÷ Cpr1.2 Based on Sample Mass:Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per gram of fresh sample.Calculation:ACK Activity (U/g fresh weight) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (W × Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ) ÷ TSimplified Formula: ACK (U/g fresh weight) = 1072 × ΔA ÷ W1.3 Based on Bacterial or Cell Density:Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per 10⁴ cells/bacteria in the reaction system.Calculation (for 5 million cells in 1 ml extract):ACK Activity (U/10⁴) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (500 × Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ) ÷ TSimplified Formula: ACK (U/10⁴) = 2.144 × ΔA1.4 Based on Liquid Volume:Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per milliliter of sample.Calculation:ACK Activity (U/mL) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ Vₛₐₘₚₗₑ ÷ TSimplified Formula: ACK (U/mL) = 1072 × ΔA2. Calculation for Micro Quartz CuvetteUse the formulas above but adjust the light path *d* from 0.5 cm to 1.0 cm.Precautions1. Keep samples and all reagents on ice during the assay procedure to prevent denaturation and loss of activity.2. The temperature of the reaction mixture must be maintained at 37°C or 25°C. When using a cuvette, a small beaker filled with deionized water pre-warmed to 37°C or 25°C (placed in a water bath) can be used to hold the cuvette and maintain temperature during the reaction.3. This product is for scientific research use only. It is not intended for clinical diagnosis. For your safety and health, please wear a lab coat and disposable gloves during operation... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665989Component240 TStorageN665989AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665989BlIndex N901-N924 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle.Note: The amount of individual primers used is 1 µl, each N7-endProducts contentN665989Component240 TStorageN665989AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665989BlIndex N901-N924 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle.Note: The amount of individual primers used is 1 µl, each N7-end primer can perform 10 DNA library constructs, and each kit can perform 240 DNA library constructs. Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. ProcedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol.Index N501 Primer for IlluminaIndex N901-N996 Primer for Illumina... Read More | Product content： Component S665549 50 preps Buffer SW 60 ml Buffer SL 60 ml Buffer GL 50 ml Buffer GW1（concentrate） 2X13 ml Buffer GW2（concentrate） 15 ml Buffer GE 15 ml Spin Columns DM 50 with Collection Tubes 50Product IntroductionThis kit is suitable for Product content： Component S665549 50 preps Buffer SW 60 ml Buffer SL 60 ml Buffer GL 50 ml Buffer GW1（concentrate） 2X13 ml Buffer GW2（concentrate） 15 ml Buffer GE 15 ml Spin Columns DM 50 with Collection Tubes 50Product IntroductionThis kit is suitable for extracting total DNA from fecal samples, including the total DNA of cells, bacteria, parasites, and viruses in the samples, as well as samples containing high concentrations of PCR reaction inhibitors. This product can process up to 300 mg of fecal samples and purify to obtain mainly 20-30 kb DNA fragments. The purification process does not require toxic solvents such as phenol or chloroform, and does not require ethanol precipitation. High purity DNA can be obtained within one hour. This reagent kit adopts a unique buffering system to efficiently bind DNA from the lysis solution to the adsorption column. At the same time, protein impurities and other organic compounds that inhibit downstream reactions in feces can flow through the membrane. Inhibitors of PCR and enzyme reactions, as well as residual impurities, can be effectively removed through two washing steps. Finally, high-purity DNA can be obtained by washing with low salt buffer or water. The purified DNA can be directly used for downstream experiments such as enzyme digestion, PCR, Real Time PCR, library construction, Southern Blot, and molecular labeling.Preparation and important precautions before the experiment1. Samples should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2.Before the first use, anhydrous ethanol should be added to Buffer GW1 and GW2 according to the instructions on the reagent bottle label.3. Before use, please check whether there is crystallization or precipitation in Buffer SL and Buffer GL. If there is crystallization or precipitation, please dissolve Buffer SL and Buffer GL again in a 56 ℃ water bath.4. If downstream experiments are sensitive to RNA contamination, 4 can be added after adding Buffer SL µ RNase A of DNase Free (100 mg/ml) is not provided in this kit. If needed, it can be ordered separately from our company, item number: S665549Operation steps1. Take a fecal sample of 100-300 mg and place it in a centrifuge tube (provided by oneself).2. Add 1 ml of Buffer SW and vortex for 3-5 minutes to evenly disperse the sample in the solution. Centrifuge at 12000 rpm (~13400 × g) for 1 minute and discard the supernatant.3. Add 1 ml of Buffer SL and vortex for 3-5 minutes to evenly disperse the sample in the solution. Take a water bath at 65 ℃ for 20 minutes and vortex for 15 seconds every 5 minutes. Note: To remove RNA, add 4 after completing the above steps µ RNase A solution (product number: CW0601S) with a concentration of 100 mg/ml, shake well and let stand at room temperature for 5-10 minutes.4.Centrifuge at 2000 rpm for 3 minutes and transfer the supernatant to a new centrifuge tube (provided by oneself).5. Add an equal volume of Buffer GL to the supernatant, invert and mix 15-25 times, and leave on ice for 5 minutes. Centrifuge at 12000 rpm for 5 minutes. Attention: At this time, the liquid may be in a transparent or turbid state, which does not affect the experiment. 6. Add the supernatant obtained in step 5 to the spin columns DM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm (~13400 × g) for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. 8. Repeat step 7.9. Add 500 to the adsorption column µ Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.10.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).11. Place the adsorption column in a new centrifuge tube (self provided) and add 50-100 drops of suspended droplets to the middle of the adsorption column µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Note: 1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency will be reduced2) Incubating at room temperature for 5 minutes before centrifugation can increase yield.3) Use an additional 50-100 µ Further washing with buffer GE or sterilized water can increase yield.4) If you want to increase the final concentration of DNA, you can add the DNA eluent obtained in step 11 back onto the adsorption membrane and repeat step 11; It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ Wash with buffer GE or sterilized water.5) DNA stored in water can be affected by acidic hydrolysis. If long-term storage is required, it is recommended to elute with Buffer GE and store at -20 ℃.6) The residual trace PCR inhibitors in the genomic DNA template may have adverse effects on the PCR reaction, which can be solved by diluting DNA by 2-10 times... Read More | Products content S666097Component200 TStorageS666097A5×SuperFast One Step RT-qPCR U+ Buffer1 mL-20℃. Avoid freeze/thaw cycle.S666097BSuperFast One Step U+ Enzyme200 µL-20℃. Avoid freeze/thaw cycle.S666097CRNase-Free Water2×1.5 mL-20℃. Avoid freeze/thaw cycle. Products content S666097Component200 TStorageS666097A5×SuperFast One Step RT-qPCR U+ Buffer1 mL-20℃. Avoid freeze/thaw cycle.S666097BSuperFast One Step U+ Enzyme200 µL-20℃. Avoid freeze/thaw cycle.S666097CRNase-Free Water2×1.5 mL-20℃. Avoid freeze/thaw cycle. Products IntroductionThe SuperFast Probe One Step RT-qPCR U+ Kit is designed for quantitative PCR assays using RNA as a template (e.g., RNA viruses). Using gene-specific primers (GSP), reverse transcription and qPCR reactions are completed in a single tube, eliminating the need for additional tube-opening/pipetting operations, greatly increasing throughput and reducing the risk of contamination. The dUTP/UNG anti-contamination system is introduced in this kit. The heat-sensitive UNG rapidly degrades U-containing contaminants at room temperature; it is rapidly inactivated by reverse transcription at 55°C, without affecting the efficiency and sensitivity of qRT-PCR. Combined with optimized buffer systems and antibody-modified Taq enzymes and mutated M-MLV, the SuperFast Probe One Step RT-qPCR U+ Kit provides sensitivity up to 0.1 pg of total RNA or <10 copies of RNA template and enhanced thermal stability. 5× SuperFast One Step RT-qPCR U+ Buffer contains the following components The 5× SuperFast One Step RT-qPCR U+ Buffer contains an optimized buffer system and dNTP/dUTP Mix, which is particularly suitable for high specificity, low template concentration and multiplexed rapid detection of fluorescently labeled probes such as TaqMan. caveatBefore use, please mix the product gently by turning it up and down after it is completely melted to avoid foaming, and use it after brief centrifugation. Avoid repeated freezing and thawing of the product.ROX dye is used to correct the fluorescence signal error between the quantitative PCR wells, this product does not contain ROX dye, if you need to match the ROX dye with the instrument you are using, please contact your local business or call CombiSense customer service at 4006-222-360. PCR reaction system Attention: (1) Usually, the final primer concentration of 0.2 µM can get better results, and 0.1-1.0 µM can be used as a reference for setting the range. If the amplification efficiency is not high, the concentration of primer can be increased; if non-specific reaction occurs, the concentration of primer can be decreased to optimize the reaction system.(2) The final concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, please refer to the instrument manual or the specific requirements for the use of each fluorescent probe to adjust the concentration.3) Because templates from different species contain different numbers of copies of the target gene, the template can be diluted in a gradient to determine the optimal amount of template to usePCR reaction conditionsmovetemptimingcirculatereverse transcription55°C1 min1premutability95°C10s1)1denaturation95°C1 s40-45Annealing/Extension55-60°C2)10-15s3)40-45Attention: (1) The enzyme used in this product is activated under the condition of pre-denaturation at 95℃ for 30s. Under this condition, most of the templates can be well unchained. For templates with high GC content and complex secondary structure, the pre-denaturation time can be extended to 1min, so as to make the starting template fully unchained, and if the high temperature treatment time is too long, it will affect the activity of the enzyme; for simple templates, pre-denaturation time of 1-10s can also be used, and the optimal pre-denaturation time can be determined according to the template situation.(2) It is recommended to use two-step PCR reaction program, the annealing temperature should be 55-60℃ as the reference range, and the annealing temperature can be increased when non-specific reaction occurs. If you can't get good results due to the use of primers with low Tm values or long amplification products, you can try three-step PCR amplification.3) Whether the actual Real Time PCR instrument used supports rapid amplification cycles, please perform a pre-experiment to verify this for the first attempt... Read More |