| Description | Acridine Orange (AO) is a metachromatic fluorescent dye whose emission color varies depending on the target it binds to:When binding to double-stranded DNA: It intercalates between base pairs and emits green fluorescence upon excitation (Ex 488 nm, Em 530 nm).When binding to single-stranded RNA or Acridine Orange (AO) is a metachromatic fluorescent dye whose emission color varies depending on the target it binds to:When binding to double-stranded DNA: It intercalates between base pairs and emits green fluorescence upon excitation (Ex 488 nm, Em 530 nm).When binding to single-stranded RNA or lysosomes: It attaches via electrostatic interactions and emits orange-red fluorescence (Em 640 nm).Under a fluorescence microscope, Acridine Orange permeates the membranes of normal cells, staining the nucleus with uniform green or yellow-green fluorescence. In apoptotic cells, due to chromatin condensation and fragmentation into apoptotic bodies, AO stains them with intense, condensed yellow-green fluorescence or fragmented yellow-green particles. In necrotic cells, the yellow-green fluorescence is reduced or absent.Acridine Orange is often used in combination with Propidium Iodide (PI) for dual staining. Since PI stains only dead cells, producing orange-red fluorescence, this method allows differentiation among normal, apoptotic, and necrotic cells.ComponentsA1456513Component50 Test100 TestStorage ConditionQuantity Per TestA1456513ADilution Buffer10 mL50 mL2-8℃0.1 mL per 0.5-1.0 × 10⁶ cellsA1456513BAO Staining Solution100 µL500 µL2-8℃, Protect from light. Do not freeze1 µL per 0.5-1.0 × 10⁶ cellsNote: The recommended number of cells to stain per test is 0.5-1.0 × 10⁶ cells.Procedure1. Preparation of Acridine Orange Staining Solution b. Mix the AO Staining Solution with the Dilution Buffer at a ratio of 1:1000 to prepare the working solution. For example, add 10 µL of AO Staining Solution to 10 mL of Dilution Buffer to obtain 10 mL of Acridine Orange staining solution. 2. Staining with Acridine Orangea. For adherent cells: (a) Gently aspirate the culture medium from the plate. Rinse with PBS for about 10 seconds, then remove PBS. (b) Add Acridine Orange staining solution and incubate at room temperature for 5 minutes. Remove the staining solution and rinse with PBS for about 10 seconds. Repeat the rinse once. Note: For adherent cells cultured in a 6-well plate with a confluence exceeding 80%, it is recommended to add the staining working solution at a volume of 1 mL per well. This volume can be optimized based on the specific experimental system.(c) Incubate at room temperature for 5 minutes. (c) Add an appropriate amount of cell culture medium, staining buffer, or other suitable solution to cover the well bottom. Observe under a microscope. Depending on the detection requirements, green fluorescence can be observed at Ex/Em = 488/530 nm, and red fluorescence can be observed at Ex/Em = 540/640 nm. Alternatively, measure fluorescence intensity using a fluorescence microplate reader with bottom-reading capability.b. For suspension cells: (a) Take 1 mL of cell suspension. Centrifuge at 500g for 5 minutes at room temperature. Gently aspirate the medium, resuspend in PBS, and centrifuge again at 500g for 5 minutes. Remove PBS. (b) Add an appropriate amount of Acridine Orange staining solution to achieve a cell density of approximately 10⁶ cells/mL.(c) Incubate at room temperature for 5 minutes. (d) A drop of the sample was directly applied onto a glass slide, covered with a coverslip, and examined under a microscope. Depending on the detection requirements, green fluorescence can be observed at Ex/Em = 488/530 nm, and red fluorescence can be observed at Ex/Em = 540/640 nm. Alternatively, after staining, analyze directly by flow cytometry or measure fluorescence with a microplate reader.Note: Centrifugation to remove staining solution can reduce background fluorescence. For suspension cells or adherent cells in suspension, consider reducing the AO staining solution concentration by 2–5 times and shortening the staining time to 2 minutes.Precautions1. AO Staining Solution is toxic. Handle with care. 2. For your safety and health, wear a lab coat and disposable gloves. 3. Fluorescent dyes are susceptible to quenching. It is recommended to complete detection on the same day after staining... Read More | Inquire | FFPE DNA/RNA KitFixed Tissue DNA/RNA Extraction Kit Catalog number: F666120 (50 preps)Storage conditions: DNase I and 10×Reaction Buffer -20℃, Spin Columns DF and Spin Columns RS can be stored at room temperature for 2 months, 2-8℃ for 1 year, the rest of the components are stored FFPE DNA/RNA KitFixed Tissue DNA/RNA Extraction Kit Catalog number: F666120 (50 preps)Storage conditions: DNase I and 10×Reaction Buffer -20℃, Spin Columns DF and Spin Columns RS can be stored at room temperature for 2 months, 2-8℃ for 1 year, the rest of the components are stored at room temperature (15-30℃).Products Content:Products IntroductionThis kit is suitable for the effective purification of genomic DNA and total RNA from paraffin-embedded tissues, using specially optimized deparaffinizing agents and lysates to release DNA and RNA from tissue section samples, without the use of the organic reagent xylene, and without the need for overnight operation; the digested samples are incubated at higher temperatures to remove inhibitors caused by cross-linking, which can effectively improve nucleic acid yields and purity; and an optimized buffer system allows nucleic acids in the lysate to bind specifically to the adsorbent membrane, and inhibitors are effectively removed by a two-step rinsing procedure. The optimized buffer system enables the nucleic acids in the lysate to bind specifically to the adsorbent membrane, and the inhibitors are effectively removed by a two-step rinsing step, and finally eluted with low-salt buffer or water to obtain high purity DNA and RNA, and at the same time, equipped with a high-efficiency microsorbent column, the volume of the elution can be as low as 20 µl. The purified DNA and RNA can be directly used for PCR, Real-time PCR, SNP genotyping, STR genotyping, and so on. The purified DNA and RNA can be directly used for PCR, Real-time PCR, SNP genotyping, STR genotyping, second-generation sequencing, pharmacogenomics research and blot analysis.Self-contained reagent: anhydrous ethanolPre-experiment Preparation and Important Notes 1. After obtaining the sample, fix the sample as soon as possible, the fixation time of 14-24 hours is appropriate, too long a period of time will easily lead toDNA and RNA breaks, affecting downstream experiments. If the formaldehyde fixation time is too long or the sample is stored for too long(>1 year) is prone to compromise DNA integrity and failure to amplify long fragments.2. Ensure that samples are thoroughly dehydrated prior to embedding; residual formalin will inhibit Proteinase K action.3. Add 1.25 ml of Proteinase K Storage Buffer to Proteinase K to dissolve it, and store at -20℃. Do not leave the prepared Proteinase K at room temperature for a long period of time to avoid affecting its activity.4. Anhydrous ethanol should be added to Buffer RW2, Buffer GW1 and Buffer GW2 according to the label instructions on the vials before first use.5. Check Buffer GTL, Buffer GL and Buffer DS for crystallization or precipitation prior to use; if crystallization or precipitation occurs, redissolve Buffer GTL, Buffer GL and Buffer DS in a 37°C water bath.6. Preheat the water bath or thermostatic mixer to 56°C before starting the experiment.7. Use an ambient temperature centrifuge or set the centrifuge temperature to 25°C. Temperatures below 15°C may result in clogging of the adsorption column.8. To prevent RNase contamination, the following should be observed:1) Use RNase-free plastics and tips to avoid cross-contamination.(2) Glassware should be dry baked at 180°C for 4 hours before use, plasticware can be soaked in 0.5 M NaOH for 10 minutes, rinsed thoroughly with water and autoclaved.3) RNase-free water should be used to prepare the solution.(4) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.procedureParaffin-embedded samples1. Trim off excess paraffin from the tissue block to expose the tissue and cut into 5-10 µm slices.2. Place approximately 1 x 1 cm2 slices (1-5 slices in total) in a centrifuge tube (supplied), add 500 µl of Buffer DS and vortex for 10 s. Briefly centrifuge the sample to the bottom of the tube. Centrifuge briefly to collect the sample at the bottom of the tube, incubate at 56°C for 3 minutes, remove from the water bath and allow to cool to room temperature before proceeding.Note: If the surface of the sample is exposed to air, discard the initial 2-3 slices without using them.3. Centrifuge at 12,000 rpm for 2 minutes and carefully discard the supernatant thoroughly without aspirating the precipitate. The residual dewaxing solution can be carefully removed with a small tip (10 µl).4. Add 180 µl of Buffer GTL and 20 µl of Proteinase K to the above tube and mix well with vortexing.5. Incubate at 56°C for 15 minutes, then place on ice for 3 minutes. Centrifuge at 12,000 rpm for 15 minutes at room temperature.6. Transfer the supernatant to a new 1.5 ml centrifuge tube for RNA extraction, taking care not to aspirate undigested tissue. Use the precipitate for DNA extraction. RNA extraction7. Take the supernatant obtained in step 6 and incubate at 80°C for 15 minutes.8. Add 320 µl of Buffer GL, mix by vortexing and shaking, then add 720 µl of anhydrous ethanol and mix immediately by vortexing and shaking.9. Add all of the resulting solution to the Spin Columns RS in the collection tube; if the solution cannot be added all at once, it may be transferred in several passes. centrifuge the column at 12,000 rpm for 1 minute, pour off the waste solution from the collection tube, and place the column back into the collection tube. Note: If the columns are clogged, the sample size may be too large and consideration should be given to reducing the number of starting sections to 1-2.Optional step: If genomic DNA is to be removed, the following steps can be followeda. Add 350 µl of Buffer RW1 to the column, centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and place the column back into the collection tube.b. Preparation of DNase I mixture: Take 52 µl of RNase-Free Water and add 8 µl of 10×Reaction to it.Buffer and 20 µl DNase I (1 U/µl), mix well, and prepare a final volume of 80 µl of reaction solution.c. Add 80 µl of DNase I Mix directly to the adsorption column and incubate at 20-30°C for 15 minutes.d. Add 350 µl of Buffer RW1 to the column, centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and return the column to the collection tube.Add 500 µl of Buffer RW2 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.11. Repeat step 10. centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Place the column at room temperature for 5 minutes.minutes to dry thoroughly.12. Place the column in a new RNase-free centrifuge tube and add 20-50 µl to the center of the column.RNase-Free Water, left at room temperature for 5 minutes, centrifuged at 12,000 rpm for 1 minute, and collected RNA solution, the-80°C for storage.DNA extraction7. Take the precipitate obtained in step 6 and add 180 µl Buffer GTL and 20 µl Proteinase K to the precipitate. VortexResuspend the precipitate for 15 seconds.8. Incubate at 56°C for 1 hour until the sample is completely dissolved. 90°C for 1 hour.Add 200 µl Buffer GL, vortex and shake to mix and then add 200 µl anhydrous ethanol, vortex and shake to mix thoroughly. Centrifuge briefly so that the solution on the wall of the tube collects at the bottom of the tube. Add all of the solution from step 9 to the Spin Columns DF in the collection tube, or transfer the solution in several passes. centrifuge at 12,000 rpm for 1 minute, pour off the waste solution from the collection tube, and return the column to the 10. collection tube.Note: If the adsorption column is clogged, the sample size may be too large and consideration should be given to reducing the number of starting sections to 1-2.11. Add 500 µl of Buffer GW1 to the adsorbent column and centrifuge at 12,000 rpm for 1 minute. Pour off the waste liquid from the collection tube and put the column back into the collection tube.12. Add 500 µl of Buffer GW2 to the adsorbent column and centrifuge at 12,000 rpm for 1 minute. Pour off the waste liquid from the collection tube and place the column back into the collection tube.Note: Step 12 may be repeated if further purity is required.13. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for 5 minutes to dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorbent column; ethanol residue will affect the subsequent enzymatic reaction. 14. Place the column in a new 1.5 ml centrifuge tube, add 20-50 µl Buffer EB to the center of the column, leave at room temperature for 5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store at -20℃... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentNote: The amount of individual primers used is 1 µl, each N7-end primer can perform 10 DNA library constructs, and each kit can perform 240 DNA library constructs.Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Products contentNote: The amount of individual primers used is 1 µl, each N7-end primer can perform 10 DNA library constructs, and each kit can perform 240 DNA library constructs.Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes; Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. procedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol. Index N501 Primer for Illumina Index N901-N996 Primer for Illumina... Read More |