| Description | Acridine Orange (AO) is a metachromatic fluorescent dye whose emission color varies depending on the target it binds to:When binding to double-stranded DNA: It intercalates between base pairs and emits green fluorescence upon excitation (Ex 488 nm, Em 530 nm).When binding to single-stranded RNA or Acridine Orange (AO) is a metachromatic fluorescent dye whose emission color varies depending on the target it binds to:When binding to double-stranded DNA: It intercalates between base pairs and emits green fluorescence upon excitation (Ex 488 nm, Em 530 nm).When binding to single-stranded RNA or lysosomes: It attaches via electrostatic interactions and emits orange-red fluorescence (Em 640 nm).Under a fluorescence microscope, Acridine Orange permeates the membranes of normal cells, staining the nucleus with uniform green or yellow-green fluorescence. In apoptotic cells, due to chromatin condensation and fragmentation into apoptotic bodies, AO stains them with intense, condensed yellow-green fluorescence or fragmented yellow-green particles. In necrotic cells, the yellow-green fluorescence is reduced or absent.Acridine Orange is often used in combination with Propidium Iodide (PI) for dual staining. Since PI stains only dead cells, producing orange-red fluorescence, this method allows differentiation among normal, apoptotic, and necrotic cells.ComponentsA1456513Component50 Test100 TestStorage ConditionQuantity Per TestA1456513ADilution Buffer10 mL50 mL2-8℃0.1 mL per 0.5-1.0 × 10⁶ cellsA1456513BAO Staining Solution100 µL500 µL2-8℃, Protect from light. Do not freeze1 µL per 0.5-1.0 × 10⁶ cellsNote: The recommended number of cells to stain per test is 0.5-1.0 × 10⁶ cells.Procedure1. Preparation of Acridine Orange Staining Solution b. Mix the AO Staining Solution with the Dilution Buffer at a ratio of 1:1000 to prepare the working solution. For example, add 10 µL of AO Staining Solution to 10 mL of Dilution Buffer to obtain 10 mL of Acridine Orange staining solution. 2. Staining with Acridine Orangea. For adherent cells: (a) Gently aspirate the culture medium from the plate. Rinse with PBS for about 10 seconds, then remove PBS. (b) Add Acridine Orange staining solution and incubate at room temperature for 5 minutes. Remove the staining solution and rinse with PBS for about 10 seconds. Repeat the rinse once. Note: For adherent cells cultured in a 6-well plate with a confluence exceeding 80%, it is recommended to add the staining working solution at a volume of 1 mL per well. This volume can be optimized based on the specific experimental system.(c) Incubate at room temperature for 5 minutes. (c) Add an appropriate amount of cell culture medium, staining buffer, or other suitable solution to cover the well bottom. Observe under a microscope. Depending on the detection requirements, green fluorescence can be observed at Ex/Em = 488/530 nm, and red fluorescence can be observed at Ex/Em = 540/640 nm. Alternatively, measure fluorescence intensity using a fluorescence microplate reader with bottom-reading capability.b. For suspension cells: (a) Take 1 mL of cell suspension. Centrifuge at 500g for 5 minutes at room temperature. Gently aspirate the medium, resuspend in PBS, and centrifuge again at 500g for 5 minutes. Remove PBS. (b) Add an appropriate amount of Acridine Orange staining solution to achieve a cell density of approximately 10⁶ cells/mL.(c) Incubate at room temperature for 5 minutes. (d) A drop of the sample was directly applied onto a glass slide, covered with a coverslip, and examined under a microscope. Depending on the detection requirements, green fluorescence can be observed at Ex/Em = 488/530 nm, and red fluorescence can be observed at Ex/Em = 540/640 nm. Alternatively, after staining, analyze directly by flow cytometry or measure fluorescence with a microplate reader.Note: Centrifugation to remove staining solution can reduce background fluorescence. For suspension cells or adherent cells in suspension, consider reducing the AO staining solution concentration by 2–5 times and shortening the staining time to 2 minutes.Precautions1. AO Staining Solution is toxic. Handle with care. 2. For your safety and health, wear a lab coat and disposable gloves. 3. Fluorescent dyes are susceptible to quenching. It is recommended to complete detection on the same day after staining... Read More | Product IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized stateProduct IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized state, it appears purple-blue and non-fluorescent, while in the reduced state, it turns into a reduction product with pink or red fluorescence, with an absorption peak of 530-560nm and an emission peak of 590nm.In the process of cell proliferation, the ratios of NADPH/NADP, FADH/FAD, FMNH/FMN and NADH/NAD in the cell increase and are in a reducing environment. The dye taken into the cell is reduced by these metabolic intermediates and cytochromes and then released outside the cell and dissolved in the culture medium, changing the culture medium from non-fluorescent indigo blue to fluorescent pink. Finally, use an ordinary spectrophotometer or fluorophotometer for detection, and the absorbance and fluorescence intensity are proportional to the number of active cells.Instructions1. Add 10µl of detection reagent to 100µl of cell suspension, and incubate in a cell incubator for 2-6 hours. The color of the medium changes from indigo blue to pink and you can proceed to the next step.2. It is recommended to use a fluorescence microplate reader for detection, the excitation light wavelength is between 530-560 nm, the emission light wavelength is 590 nm, and the relative fluorescence unit (RFU) is recorded.3. Draw a standard curve or cell growth curve: the ordinate (Y axis) is the relative fluorescence unit (RFU); the abscissa (X axis) is the cell number or time point or drug concentration.Precautions1. The appropriate density of cells can increase the detection sensitivity. For 96-well plates, we recommend seeding 100 microliters of cells per well. The cell concentration range is: 100-10,000/well for adherent cells, 2,000-50,000/well for suspension cells, and medium as a blank control. For 384-well plates, the cell concentration and seeding volume are both halved.2. The whole process should be aseptic operation, because microbial contaminants can also reduce the detection reagents and affect the experimental results.3. Pay attention to the concentration of inoculated cells and the incubation time after adding detection reagents. If the cell concentration is too high or the incubation time is too long, it will cause a secondary reduction reaction, resulting in colorlessness and disappearance of fluorescence.4. When incubating, avoid light.5. This product can use fluorescence or spectrophotometric detection, but the sensitivity of fluorescence is high, and the experimental error is small. Fluorescence detection is recommended... Read More | Product content: G665990Component200 TStorageG665990ABuffer PG100 mLRTG665990BBuffer PS60 mLRTG665990CBuffer PW (concentrate)50 mLRTG665990DBuffer EB30 mLRTG665990ESpin Columns DM with Collection Tubes200 EART Product Introduction:This kit uses a new silicon-based plasma membrane technology and Product content: G665990Component200 TStorageG665990ABuffer PG100 mLRTG665990BBuffer PS60 mLRTG665990CBuffer PW (concentrate)50 mLRTG665990DBuffer EB30 mLRTG665990ESpin Columns DM with Collection Tubes200 EART Product Introduction:This kit uses a new silicon-based plasma membrane technology and reagent formulation. Through the unique centrifugal adsorption column and the DNA washing elution step, 100 bp-10 kb DNA fragments can be recovered and purified from ordinary or low melting point agarose gel. The sol speed is fast and the recovery rate is high. The sol solution contains a pH indicator, which can be used to determine whether the sol recovery has reached the optimal state based on its color. Each adsorption column can adsorb up to 10 µ G DNA, while effectively removing impurities such as primers, enzymes, mineral oil, and agarose. The purified and recovered DNA has high purity and concentration, good integrity, and can be directly used for molecular biology experiments such as sequencing, linking and transformation, labeling, and in vitro transcription.Self prepared reagents: anhydrous ethanol, isopropanol.Preparation and important precautions before the experiment:1.Before the first use, anhydrous ethanol should be added to the Buffer PW according to the instructions on the reagent bottle label.2. Before use, please check the Buffer PG. If crystallization or precipitation occurs, it can be left in a 37 ℃ water bath for 3-5 minutes to restore clarity.3. It is best to use a new electrophoresis buffer during electrophoresis to avoid affecting the electrophoresis and recovery efficiency; The following experiment requires high requirements, please use TAE electrophoresis buffer as much as possible.4.When cutting glue, the UV irradiation time should be as short as possible to avoid damage to DNA.5. The recovery rate is related to the initial amount of DNA and the elution volume. The smaller the initial amount, the smaller the elution volume, and the lower the recovery rate.6. Preheat the water bath to 50 ℃.7. Buffer PG contains a pH indicator. When the pH is ≤ 7.5, the color of the solution is yellow, and DNA can effectively bind to the membrane. When the pH is too high, the color of the solution turns orange red and purple, which needs to be adjusted.8. All centrifugation steps can be performed at room temperature.Operation steps:1. Cut the single purpose DNA strip from the agarose gel (try to cut the excess), put it into a clean centrifuge tube (self prepared), and weigh and calculate the weight of the gel (record the weight of the centrifuge tube in advance).Attention: If the volume of the adhesive block is too large, it can be cut into small pieces.2. Add one time of the volume of Buffer PG (if the gel weighs 100 mg, its volume can be regarded as 100 µ l. And so on.3.50 ℃ water bath and gently invert the centrifuge tube every 2-3 minutes until the sol turns yellow to ensure full dissolution of the gel block. If there are still unsolved glue blocks, you can add some more sol solution or continue to let it stand for a few minutes until the glue blocks are completely dissolved.Note: 1) After the gel is completely dissolved, the gel solution is yellow, and subsequent operations can be carried out; If the glue solution is orange red or purple, 10-30 can be added to the glue solution µ 3 M sodium acetate (pH 5.0), adjust the color of the solution to yellow before proceeding with subsequent operations.2) After the gel block is completely dissolved, it is best to lower the temperature of the gel solution to room temperature before loading the column. The adsorption column has a weaker ability to bind DNA at higher temperatures.4. (Optional step) When the recovered fragment is less than 300 bp, add 1/2 of the gel volume of isopropanol, and mix it upside down (if the gel weighs 100 mg, add 50 µ Isopropanol of L.5. Column balance: Add 200 to the spin columns DM that have been loaded into the collection tube µ Centrifuge at 13000 rpm (~16200 × g) for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add the solution obtained from steps 3 or 4 to the adsorption column that has been loaded into the collection tube, let it stand at room temperature for 2 minutes, centrifuge at 13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube.Attention: The volume of the adsorption column is 750 µ l. If the sample volume is greater than 750 µ L can be added in batches.7. Add 450 to the adsorption column µ LBuffer PW (please check if anhydrous ethanol has been added before use), centrifuge at 13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube.Note: If purified DNA is used for salt sensitive experiments (such as flat end ligation or direct sequencing), it is recommended to add Buffer PW and let it stand for 2-5 minutes before centrifugation.8. Repeat step 7.9.13000 rpm for 1 minute and discard the waste liquid from the collection tube.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column into a new 1.5 ml centrifuge tube (provided by oneself), and add 50 drops to the middle position of the adsorption membrane in the air µ L Buffer EB, leave at room temperature for 2 minutes. Centrifuge at 13000 rpm for 1 minute and collect DNA solution- Store DNA at 20 ℃.Attention:1) To improve the recovery of DNA, the solution obtained by centrifugation can be re dropped onto the adsorption column, left at room temperature for 2 minutes, and centrifuged at 13000 rpm for 1 minute.2) The elution volume should not be less than 30 µ l. A small volume will affect the recovery efficiency.3) When recovering DNA fragments larger than 10 kb, Buffer EB should be preheated in a 50 ℃ water bath to increase recovery efficiency.Note: This reagent kit is also suitable for the purification and recovery of PCR products. Add an equal volume of Buffer PG to the PCR reaction solution and mix thoroughly (for small fragments with a recovery of less than 150bp, the solution volume can be increased to three times to improve the recovery rate). Follow step 5 above for further operations... Read More | Product content: M665794Component125 TStorageM665794A2×miRNA qPCR Mixture (ROX)2×750 µL-20℃. Avoid freeze/thaw cycleM665794BReverse Primer, 10 µM60 µL-20℃. Avoid freeze/thaw cycleM665794CddH2O1.5 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kitProduct content: M665794Component125 TStorageM665794A2×miRNA qPCR Mixture (ROX)2×750 µL-20℃. Avoid freeze/thaw cycleM665794BReverse Primer, 10 µM60 µL-20℃. Avoid freeze/thaw cycleM665794CddH2O1.5 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kit uses the principle of SYBR Green I chimeric fluorescent dye method for miRNA fluorescence quantitative PCR detection. The kit includes 2 x miRNA qPCR Mixture and Reverse Primer required for detection. 2 x miRNA qPCR Mixture is a new generation pre mixed form of fluorescence quantitative PCR detection reagent specially developed for miRNA quantitative detection. The fluorescent dye SYBR Green I contained in it can bind to all double stranded DNA, making the product suitable for detecting different target sequences without the need to synthesize specific labeled probes. The GoldStar Taq DNA polymerase is a chemically modified and highly efficient thermal starter enzyme, coupled with a unique buffer system, which enhances reaction specificity, sensitivity, and enables accurate quantification of miRNA over a wider range. The 2x miRNA qPCR Mixture contains ROX dye and is suitable for fluorescence quantitative PCR instruments that require ROX as a calibration dye.Note: This kit must be used in conjunction with the miRNA cDNA first strand synthesis kit.Self prepared experimental materials: qPCR upstream primer.Forward Primer design principles:1. Follow the most common principles of primer design.2.Based on mature miRNA sequences, replacing U with T is the most basic and simplest design method.3.The Tm value of the downstream primer provided in the reagent kit is 63.6 ℃, and the Tm value of the upstream primer should be designed to be around 63.6 ℃ as much as possible.4. If the Tm value of the primer directly designed according to principle "2" is too low, several bases (preferably G or C bases) can be added to the 5 'end of the primer; One or several A bases can also be added at the 3 'end; Alternatively, both the 5 'and 3' ends can be modified simultaneously.5.If the Tm value of a primer designed directly according to principle "2" is too high, several bases can be removed from the 5 'or 3' end of the primer.Notes:1. Before using the reagent, please gently mix it upside down to avoid foaming, and use it after a brief centrifugation.2. The amount of miRNA first strand cDNA added should not exceed 10% of the volume of Real time PCR.3. For special detection systems, high content of cDNA templates can easily lead to non-specific amplification. Dilute cDNA appropriately (10 or 100 times dilution) based on the abundance of detected miRNAs.4. The 2x miRNA qPCR Mixture in this product contains SYBR Green I and ROX dyes. When storing this product or preparing PCR reaction solution, strong light exposure should be avoided.5. Avoid repeated freezing and thawing of this product. Repeated freezing and thawing may cause a decrease in product performance. This product can be stored at -20 ℃ for long-term storage. If frequent use is required in the short term, the 2xmiRNA qPCR Mixture can be stored at 2-8 ℃. However, the Reverse primer still needs to be stored at -20 ℃.Operation steps:1. Melt 2 x miRNA qPCR Mixture and Reverse Primer at room temperature (10 µ M). 2. When using, please gently mix the 2x miRNA qPCR Mixture upside down to avoid foaming, and use after brief centrifugation. If the reagent is not well mixed, its reaction performance will decrease.3. Place the reagent on ice and prepare the reaction system according to the following table: reagent volume final concentration 2×miRNA qPCR Mixture（ROX） 10 µl 1× Forward primer（10 µM） 0.4µl 0.2 µM Reverse primer（10 µM） 0.4µl 0.2 µM MiRNA first strand cDNA X µl — ddH2O up to 20 µl —4. The reaction program is set as follows:Attention!The pre denaturation reaction of this product must be completed at 95 ℃ for 10 minutes! Note: 1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 10 minutes.2) The annealing temperature should be set at 60-64 ℃ as a reference range. When non-specific reactions occur, the annealing temperature can be increased... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |