| Description | Inquire | Product content C665709Component50 TStorageC665709ABuffer CL45 mLRTC665709BBuffer CB (concentrate)60 mLRTC665709CBuffer GW1 (concentrate)13 mLRTC665709DBuffer GW2 (concentrate)15 mLRTC665709EBuffer EBL10 mLRTC665709FProteinase K100 mgRTC665709GProteinase K Storage Buffer5 mLRTC665709HSpin Columns DFProduct content C665709Component50 TStorageC665709ABuffer CL45 mLRTC665709BBuffer CB (concentrate)60 mLRTC665709CBuffer GW1 (concentrate)13 mLRTC665709DBuffer GW2 (concentrate)15 mLRTC665709EBuffer EBL10 mLRTC665709FProteinase K100 mgRTC665709GProteinase K Storage Buffer5 mLRTC665709HSpin Columns DF with Collection Tubes50 EA2-8℃C665709ICentrifuge Tubes (L-1.5 mL)50 EART Product IntroductionThis kit is suitable for the extraction of free DNA from fresh or frozen serum, plasma, lymph fluid and other cell-free body fluids.This kit adopts centrifugal adsorption columns that can specifically bind nucleic acids and a unique buffer system.After the sample is lysed, the free DNA binds to the silica gel membrane under high salt conditions, and the free DNA elutes from the silica gel membrane at low salt and high pH. The product can handle liquid samples of 0.1-1 ml, and the elution volume of the configured high-efficiency micro adsorption column can be as low as 20 µl. The purified DNA is of high yield and quality, with maximum removal of proteins, pigments, lipids, and other inhibitors, and the rate of free DNA yield is highly dependent on the type of samples, storage conditions, time, and inter-individual variations. The quality of free DNA obtained from purification is stable and reliable, and can be directly used in molecular biology experiments such as PCR, fluorescence quantitative PCR and second generation sequencing.Self-contained reagents: anhydrous ethanol, isopropanol.Pre-experiment Preparation and Important NotesAdd 5 ml of Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time.Repeated freezing and thawing of the sample should be avoided, as this can lead to a decrease in extraction.This kit can extract 0.1-1 ml of liquid samples.Before use, please check Buffer CL, Buffer CB for crystallization or precipitation, if there is any crystallization or precipitation, please re-dissolve Buffer CL, Buffer CB by incubation at 56℃ in a water bath.Before first use isopropyl alcohol should be added to Buffer CB according to the instructions on the reagent bottle label, mixed well, and labeled on the reagent bottle label.Before the first use, anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the label of the reagent bottle, mixed well, and labeled on the label of the reagent bottle.Preheat the water bath to 60°C before starting the experiment.The elution buffer Buffer EBL can be preheated to 60°C and used.Operation stepsAdd 20 µl of Proteinase K to the centrifuge tube (supplied).Add 200 µl of serum/plasma sample.Note: When the sample volume exceeds 200 µl, please increase the amount of Proteinase K, Buffer CL and Buffer CB reagents in equal proportions, and the specific amount of reagents added can be referred to the attached table.3. Add 160 µl Buffer CL, mix upside down and shake vigorously for at least 30 seconds.4. Incubate at 60°C for 30 minutes, during which time mixing was inverted several times.Note: Incubation of 200µl serum/plasma samples at 60°C for 10-15 minutes is sufficient.Add 360 µl of Buffer CB (check for addition of isopropanol before use) and shake until thoroughly mixed.Ice bath for 5 minutes and centrifuge briefly to concentrate the liquid on the walls and wall caps to the bottom of the tube.Add all of the solution obtained in step 6 to the adsorption columns (Spin Columns DF) that have been loaded into the collection tubes, and if the solution cannot be added all at once, it can be transferred in several times. centrifuge the columns at 12,000 rpm for 1 minute, pour off the waste solution from the collection tubes, and put the columns back into the collection tubes.Add 500µl of Buffer GW1 to the adsorbent column (check that anhydrous ethanol is added before use),centrifuge the column at 12,000rpm for 30 seconds, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.Add 750 µl Buffer GW2 to the adsorbent column (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 30 seconds, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.10. Add 750 µl of anhydrous ethanol to the adsorbent column and centrifuge at 12,000 rpm for 30 s. Pour off the waste liquid in the collection tube and put the adsorbent column back into the collection tube.11. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can interfere with the subsequent enzymatic reaction.12. Place the adsorption column in a new centrifuge tube, add 20-100 µl Buffer EBL or sterilized water to the middle part of the adsorption column overhanging the column, leave it at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20℃.Note: 1) If the downstream experiment is sensitive to pH, you can use sterilized water for elution. The pH value of the eluent has a great influence on the elution efficiency, if water is used as the eluent should ensure that its pH value is 7.0-8.5 (you can use NaOH to adjust the pH value of water to this range), and the elution efficiency is not high when the pH value is lower than 7.0.2) Preheat the elution buffer BufferEBL to 60℃ and use it, and incubate it at room temperature for 5 minutes before centrifugation to increase the yield.3) If the final concentration of DNA is to be increased, the resulting solution can be reintroduced into the adsorption column and left at room temperature for 2-5 minutes and centrifuged at 12,000 rpm for 1 minute.4) Because DNA preserved in water will be affected by acidic hydrolysis, for long-term storage, it is recommended to elute it with Buffer EBL and store it at -20℃.Table: Recommended reagent additions for different sample sizes... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Q665720 Component 200T Storage Q665720A Buffer L2 25 mL RT Q665720B Buffer N3 80 mL RT Q665720C Buffer PB 35 mL RT Q665720D Buffer PW (concentrate) 25 mL RT Q665720E Buffer EB 30 mL RT Q665720F RNase A (10 mg/mL) 800 渭L RT Q665720G Spin Columns DM with Collection Tubes 200 EA RTProduct Q665720 Component 200T Storage Q665720A Buffer L2 25 mL RT Q665720B Buffer N3 80 mL RT Q665720C Buffer PB 35 mL RT Q665720D Buffer PW (concentrate) 25 mL RT Q665720E Buffer EB 30 mL RT Q665720F RNase A (10 mg/mL) 800 渭L RT Q665720G Spin Columns DM with Collection Tubes 200 EA RTProduct IntroductionThe biggest feature of this kit: simple and fast, high extraction volume. The whole extraction process does not take more than 10 minutes, without centrifugation to collect bacteria and resuspend the bacterium, directly add the unique super lysate Buffer L2 to the cultured bacterial solution, followed by neutralization, centrifugation and passing through the column, and the extracted plasmid can be as high as 30 µg, and maximize the removal of proteins, genomes and other impurities. The extracted plasmid DNA can be directly used for bacterial transformation, digestion, PCR, in vitro transcription, sequencing and other downstream experiments.Self-contained reagent: anhydrous ethanol.Pre-experiment Preparation and Important Notes1. The kit can be stored in a dry, room temperature (15-30°C) environment for 1 year. For longer storage, the centrifuge columns can be placed at 2-8°C.2. Before the first use, add all of the RNase A solution to Buffer N3, mix well, and store at 2-8°C.3. Anhydrous ethanol should be added to Buffer PW before the first use according to the instructions on the reagent bottle label.4. If there is any precipitation in Buffer L2 before use, please put it in a 37℃ water bath and keep mixing until the solution becomes clear before use.Operation steps1. Take 600 µl of bacterial culture into a 1.5 ml centrifuge tube (supplied).2. Add 100 µl of Buffer L2 to the above centrifuge tube and gently turn the solution up and down 8 times; the solution should change from turbid to a clear purple color, indicating complete lysis. The cleavage time should not exceed 2 minutes.3. Add 350 µl of Buffer N3 to the above centrifuge tube (please check that RNaseA has been added first) and immediately mix well by turning up and down about 8-10 times, at which point the solution should turn completely yellow and a yellow precipitate should form. centrifuge at 13,000 rpm for 2-3 minutes.4. Slowly pour the supernatant obtained in step 3 into the prepared adsorption columns (Spin Columns DM with Collection Tubes) to avoid sedimentation into the columns.5. Centrifuge at 13,000 rpm for 15 seconds, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.6. Add 150 µl Buffer PB to the adsorption column and centrifuge at 13,000 rpm for 15 seconds.7. Add 400 µl Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first) and centrifuge at 13,000 rpm for 1 minute.8. Place the adsorbent column in a new centrifuge tube (self-provided), add 30-100 µl Buffer EB to the middle part of the adsorbent membrane, centrifuge at 13,000 rpm for 1 min, collect the plasmid DNA, and store at -20°C for long term storage.When the amount of extracted bacterial liquid is >600µl, the following procedure can be used:1. This kit can extract up to 3ml of bacterial solution, if the amount of extracted bacterial solution is more than 600µl, it is necessary to centrifuge the bacterial solution exceeding 600µl at 13,000rpm for 30 seconds (to collect the bacterial body), discard the supernatant and then add 600µl of bacterial solution, and then resuspend the bacterial body at the bottom of the tube thoroughly and then proceed to the following operation.2. Add 100µl Buffer L2 to the above centrifuge tube, gently invert the solution up and down 10 times, if the solution is not clarified, need to continue to invert the mixing until the solution becomes a clear purple color, the lysis time should not be more than 2 minutes. (If the solution is still turbid, the amount of bacteria is too large, and the amount of bacteria should be reduced appropriately.)3. Add 350 µl of Buffer N3 to the above centrifuge tube (please check that RNaseA has been added first) and immediately mix well by turning up and down until the purple solution turns completely yellow and a yellow precipitate is formed before proceeding to the next step. centrifuge at 13,000 rpm for 5 minutes.4. Transfer the supernatant to a new centrifuge tube, add 200 µl of isopropanol, mix up and down several times, mix well and transfer to the adsorbent column (Spin Columns DM with Collection Tubes), due to the amount of solution is too large, this time, it is necessary to centrifuge the column in two separate times, centrifugation at 13,000 rpm for 15 seconds, pour off the waste liquid in the collection tube, and put the adsorbent column back to the The adsorbent column should be placed back into the collection tube.5. Add 150 µl Buffer PB to the adsorption column and centrifuge at 13,000 rpm for 15 seconds.6. Add 400 µl Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first) and centrifuge at 13,000 rpm for 1 minute.7. Place the adsorbent column in a new centrifuge tube (self-provided), add 50-200 µl Buffer EB to the middle part of the adsorbent membrane, leave it at room temperature for 2 min, centrifuge at 13,000 rpm for 1 min, collect the plasmid DNA, and store it at -20°C for a long time... Read More | DescriptionThe Universal Coupling Kit makes particle-based immunoassays, lateral flow tests and biomolecule separation applications more flexible than ever before. It is the only kit that allows users to select and couple their choice of carboxylated particle with their chosen protein.Employing a DescriptionThe Universal Coupling Kit makes particle-based immunoassays, lateral flow tests and biomolecule separation applications more flexible than ever before. It is the only kit that allows users to select and couple their choice of carboxylated particle with their chosen protein.Employing a unique mechanism to immobilise proteins, Anteo′s advantages outweigh those of conventional covalent chemistries such as NHS/EDC or passive binding. This facilitates coupling of antibodies with ease, improved functionality and reproducibility, leading to better uniformity between experiments.Anteo′s Activation Reagent is water-based and replaces the dry chemicals you would use with the traditional NHS/EDC method. Our One-Step-Activation only takes one hour, and improves efficiency in terms of both time and cost. It also provides the ability to either store activated particles up to 12 months for later use, or to immediately couple proteins.Particle-Based Immunoassays, Lateral Flow, Bioseparations and Immunoprecipitation... Read More |