| Description | Inquire | Format:2-ComponentEnzyme:Horseradish peroxidase | M666110 Component 96 T Storage M666110A Buffer WSL 40 mL RT M666110B Buffer MSL 40 mL RT M666110C Buffer CW1 (concentrate) 90 mL RT M666110D Buffer GW1 (concentrate) 40 mL RT M666110E Buffer GW2 (concentrate) 50 mL RT M666110F Buffer EB 30 mL RT M666110G Proteinase K 4×1.25 mL RT M666110H M666110 Component 96 T Storage M666110A Buffer WSL 40 mL RT M666110B Buffer MSL 40 mL RT M666110C Buffer CW1 (concentrate) 90 mL RT M666110D Buffer GW1 (concentrate) 40 mL RT M666110E Buffer GW2 (concentrate) 50 mL RT M666110F Buffer EB 30 mL RT M666110G Proteinase K 4×1.25 mL RT M666110H Magbeads V3 2×1 mL RTProduct Introduction：The reagent kit provides a simple, fast, and efficient method for extracting genomic DNA from blood samples. In the presence of high salt, DNA binds to the surface of silica coated Magheads. After rinsing, high-purity DNA is eluted in Buffer EB or deionized water. The purified DNA has good purity (A260/280 ratio between 1.7-1.9) and high integrity (>15 kb), and can be used for downstream experiments such as second-generation sequencing, quantitative PCR, and chip detection.Self provided instruments and reagents1) Constant temperature mixer2) 2/15 ml magnetic frame3) 32 channel nucleic acid extractor4) 96 channel nucleic acid extractor5) 96 DW Plate6) 8 channel Comb7) Spin tips pack8) Anhydrous ethanolPreparation and important precautions before the experiment1.Before the first use, add anhydrous ethanol to Buffer CW1, Buffer GW1, and Buffer GW2 according to the label of the reagent bottle and mark them properly.2.Magheads are strictly prohibited from freezing or centrifugation. Freezing and centrifugation may cause irreversible damage to Magheads.Operation stepsI. Manual single tube operation1. Use punching forceps to take 1 blood spot with a diameter of 6 mm or 4 blood spots with a diameter of 3 mm (depending on the actual situation) from the blood spot and place them in a 2.0 mL centrifuge tube.2. Add 40 to the centrifuge tube µ L Protein K and 300 µ L Buffer WSL, then place the centrifuge tube on a constant temperature mixer at 75 ℃ and 1200 rpm, shake and crack for 45 minutes to form Lysate. Remove the centrifuge tube from the constant temperature mixer, centrifuge briefly, and take the supernatant.Attention: If there is no constant temperature mixer, vortex the centrifuge tube for 10 seconds and incubate it in a 75 ℃ water bath for 30 minutes. During this period, vortex every 10 minutes for 10 seconds.3. Suck the supernatant into a new 2.0 mL centrifuge tube and add 300 µ L Buffer MSL, 300 µ L isopropanol and 20 µ L Magheads V3. Afterwards, place the centrifuge tube on a constant temperature mixer at 25 ℃ and 1600 rpm, shake and crack for 15 minutes, or invert the centrifuge tube and mix continuously for 15 minutes.4. Place the centrifuge tube on a magnetic stand and let it stand for 1 minute. After Magheads are completely adsorbed on the side wall of the centrifuge tube, discard the solution thoroughly (keep the centrifuge tube fixed on the magnetic stand).5. Remove the centrifuge tube from the magnetic frame and add 900 µ L Buffer CW1 (please check if anhydrous ethanol has been added before use), vortex point shake for 1 minute or vortex shake for 5 seconds, and then place it on a constant temperature mixer at 25 ℃ and 1600 rpm to shake and mix for 2 minutes (ensure that Magheads are in a mixed state during the shaking process). Afterwards, place the centrifuge tube on a magnetic stand and let it stand for 1 minute. After Magheads are completely adsorbed on the side wall of the centrifuge tube, gently invert the magnetic stand and wash the impurities on the centrifuge tube cover to completely discard the solution (keep the centrifuge tube fixed on the magnetic stand).6. Remove the centrifuge tube from the magnetic frame and add 500 µ L Buffer GW1 (please check if anhydrous ethanol has been added before use), vortex point shake for 1 minute or vortex shake for 5 seconds, and then place it on a constant temperature mixer at 25 ℃ and 1600 rpm to shake and mix for 2 minutes (ensure that Magheads are in a mixed state during the shaking process). Afterwards, place the centrifuge tube on a magnetic stand and let it stand for 1 minute. After Magheads are completely adsorbed on the side wall of the centrifuge tube, gently invert the magnetic stand and wash the impurities on the centrifuge tube cover to completely discard the solution (keep the centrifuge tube fixed on the magnetic stand).7. Remove the centrifuge tube from the magnetic frame and add 900 µ L Buffer GW2 (please check if anhydrous ethanol has been added before use), vortex point shake for 1 minute or vortex shake for 5 seconds, then place it on a constant temperature mixer at 25 ℃ and 1600 rpm, shake and mix for 2 minutes (ensure that Magheads are in a mixed state during the shaking process). Afterwards, place the centrifuge tube on a magnetic stand and let it stand for 1 minute. After Magheads are completely adsorbed on the side wall of the centrifuge tube, gently invert the magnetic stand and wash the impurities on the centrifuge tube cover to completely discard the solution (keep the centrifuge tube fixed on the magnetic stand).8. Remove the centrifuge tube from the magnetic frame and add 300 µ After shaking with 75% ethanol for 1 minute or 5 seconds, place the mixture on a constant temperature mixer at 25 ℃ and 1600 rpm for 2 minutes (ensure that the Magheads are in a mixed state during the shaking process). Afterwards, place the centrifuge tube on a magnetic stand and let it stand for 1 minute. After Magheads are completely adsorbed on the side wall of the centrifuge tube, gently invert the magnetic stand and wash the impurities on the centrifuge tube cover to completely discard the solution (keep the centrifuge tube fixed on the magnetic stand).9. Keep the centrifuge tube fixed on the magnetic frame, use a pipette to further remove the solution from the bottom and cover of the centrifuge tube, and then leave it at room temperature for 5-10 minutes to allow the ethanol to evaporate completely.10. Remove the centrifuge tube from the magnetic frame and add 50-200 µ L Buffer EB. Vortex oscillation causes the magnetic beads to completely suspend in the eluent and then place them on a constant temperature mixer at 56 ℃ and 1600 rpm for 10 minutes of shaking and elution, or incubate the centrifuge tube in a 56 ℃ water bath for 10 minutes, with vortex oscillation every 3 minutes for 10 seconds.11. Place the centrifuge tube on a magnetic stand and let it stand for 2 minutes. After Magheads are completely adsorbed on the side wall of the centrifuge tube, transfer the eluent to a new centrifuge tube using a pipette and store at -20 ℃ for later use.II. Matching with CWE21001. Use punching forceps to take 1 blood spot with a diameter of 6 mm or 4 blood spots with a diameter of 3 mm (depending on the actual situation) from the blood spot and place them in a 2.0 mL centrifuge tube.2. Add 40 to the centrifuge tube µ L Protein K and 300 µ L Buffer WSL, then place the centrifuge tube on a constant temperature mixer at 75 ℃ and 1200 rpm, shake and crack for 45 minutes to form Lysate.3. Add the corresponding reagents to the 96DW deep well plate according to the table below. Position Reagent 1&7 Colume Lysate: All Buffer MSL: 300 µL isopropanol：300 µL Magbeads V3: 20 µL 2&8 Colume Buffer CW1: 900 µL 3&9 Colume Buffer GW1: 500 µL 4& 10 Colume Buffer GW2: 900 µL 5& 11 Colume 75%ethanol: 300 µL 6& 12 Colume Buffer EB: 70 µL4.Place the deep well plate and magnetic sleeve that have been added to the reagent at the corresponding positions of CWE2100/CWE3200, run the blood slide extraction program, and after about 40 minutes, the program ends. Remove the deep well plate and magnetic sleeve.5.Transfer the elution products from columns 6 and 12 of the deep well plate to a 1.5 mL centrifuge tube for low-temperature storage.III. Matching with CWE9601. Use punching forceps to take 1 blood spot with a diameter of 6 mm or 4 blood spots with a diameter of 3 mm (depending on the actual situation) from the blood spot and place them in a 2.0 mL centrifuge tube.2. Add 40 to the centrifuge tube µ L Protein K and 300 µ L Buffer WSL, then place the centrifuge tube on a constant temperature mixer at 75 ℃ and 1200 rpm, shake and crack for 45 minutes to form Lysate.3. Add the corresponding reagents to the 96DW deep well plate according to the table below Position Reagent Plate 1 Lysate: All Buffer MSL: 300 µL isopropanol ：300 µL Magbeads V3: 20 µL Plate 2 Buffer CW1: 900 µL Plate 3 Buffer GW1: 500 µL Plate 4 Buffer GW2: 900 µL Plate 5 75% ethanol : 300 µL Plate 6 Buffer EB: 70 µL4. Place the deep well plate and magnetic sleeve that have been added to the reagent at the corresponding positions on CWE960, run the blood slide extraction program, and after about 40 minutes, the program ends. Remove the deep well plate and magnetic sleeve.5. Transfer the elution products from Plate 6 to a 1.5 mL centrifuge tube for low-temperature storage... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export |