| Description | The StableLink RT-qPCR Kit (with UDG) is a two-component, probe-based RT-qPCR master mix comprising Buffer Mix and Enzyme Mix. It is designed for sensitive fluorescent quantitative PCR detection in single or multiplex RNA targets. Optimized for performance, the buffer system is uniquely formulated The StableLink RT-qPCR Kit (with UDG) is a two-component, probe-based RT-qPCR master mix comprising Buffer Mix and Enzyme Mix. It is designed for sensitive fluorescent quantitative PCR detection in single or multiplex RNA targets. Optimized for performance, the buffer system is uniquely formulated to support both Taq DNA polymerase and reverse transcriptase activity, ensuring broad target compatibility and exceptional reaction stability. This kit incorporates a dUTP/thermolabile UDG carryover prevention system, enabling rapid degradation of uracil-containing contaminants at room temperature. Applications: Qualitative/quantitative PCR, multiplex PCR.Product Component TableU1492587Component100T1000T10000TStorageU1492587AStableLink RT-PCR Buffer Mix1.25 mL12.5 mL125 mL-20℃U1492587BStableLink RT-PCR Enzyme Mix100 µL1 mL10 mL-20℃ ProtocolReaction Setup Preparation:1. Thaw all required reagents at room temperature or 4°C. Mix thoroughly before use.2. Prepare the PCR Reaction Mixture according to the table below:Component Volume for 25 µL SystemFinal ConcentrationStableLink RT-PCR Buffer Mix12.5 µL1×StableLink RT-PCR Enzyme Mix1 µL1×Primer/Probe Mix1 µL/Template5 µL/ddH2OTo 25 µL/Total Volume25 µLNote: "1x" indicates the working concentration of the enzyme mix as provided.The amounts of primers, probes, and template can be adjusted according to experimental requirements.Adjust the volumes of primers, probes, and template as needed for your specific assay; use RNase-Free ddH₂O to bring the reaction to the final volume.To prepare reaction volumes other than 25 µL (e.g., 50 µL), scale the reagent volumes proportionally (e.g., double the volumes for a 50 µL reaction).3. Mixing and Setup:After preparing the reaction mixture, mix gently by pipetting or brief vortexing. Centrifuge briefly to collect the contents at the bottom of the tube. Proceed to PCR amplification.Standard Thermal Cycling Protocol:StepTemperatureTimeCirculation150℃10min1295℃2min1395℃15s45460℃40s (Acquire Fluorescence)45... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Inquire |