| Description | Polyphenol Oxidase (PPO, EC1.10.3.1) is widely found in the plastids of plants, fungi, and insects. It is a copper-containing oxidase that can oxidize monophenols and diphenols to produce quinones, leading to browning. It is closely related to fruit and vegetable processing, tea quality, and Polyphenol Oxidase (PPO, EC1.10.3.1) is widely found in the plastids of plants, fungi, and insects. It is a copper-containing oxidase that can oxidize monophenols and diphenols to produce quinones, leading to browning. It is closely related to fruit and vegetable processing, tea quality, and tissue culture. The Plant Polyphenol Oxidase (PPO) Activity Assay Kit (Catechol, Micro method) provides a simple method to detect the activity level of polyphenol oxidase (PPO) in plant tissue samples.Detection Principle: Polyphenol oxidase (PPO) in the sample catalyzes the oxidation of catechol to produce quinones, which have a characteristic absorption peak at 410 nm. The rate of increase in absorbance at 410 nm is measured to calculate PPO activity.P1501774Component48T96TStorageP1501774AExtraction Buffer60 mL120 mL2-8℃P1501774BReagentⅠ24 mL48 mL2-8℃P1501774CReagentⅡ6 mL12 mL2-8℃. Store in the dark.Note: Before formal testing, it is recommended to perform a preliminary test with 2-3 samples expected to have significant differences.User-Prepared Instruments and ReagentsMicroplate reader or visible spectrophotometer (capable of measuring absorbance at 410 nm)96-well plate or micro glass cuvettes, adjustable micropipettes and tipsRefrigerated centrifuge, ice maker, constant temperature water bathDeionized waterHomogenizerExperimental Procedure1. Reagent PreparationReagent NameReagent PreparationNotesExtraction BufferReady-to-use; Equilibrate to room temperature before use.Store at 4°C.ReagentⅠReady-to-use; Equilibrate to room temperature before use.Store at 4°C.ReagentⅡReady-to-use; Equilibrate to room temperature before use.Store at 4°C protected from light; Toxic, handle with care.2. Sample PreparationNote: Fresh samples are recommended. If not used immediately, samples can be stored at -80°C for one month.2.1 Preparation of Crude Enzyme ExtractHomogenize the plant sample in ice-cold Extraction Buffer with a mass (g) to volume (mL) ratio of 1:5 to 1:10 (recommended: 0.1 g tissue + 1 mL Extraction Buffer). Centrifuge the homogenate at 8,000 g, 4°C for 10 minutes. Collect the supernatant and keep it on ice for assay.2.2 Boiled Sample ControlTake an appropriate amount of the crude enzyme extract and heat it in a boiling water bath for 5 minutes (seal to prevent moisture loss). Cool to room temperature.3. Assay Steps3.1 Preheat the microplate reader or visible spectrophotometer for at least 30 minutes. Set the wavelength to 410 nm. For spectrophotometers, zero the instrument with deionized water.3.2 Sample Measurement (Add reagents sequentially into 1.5 mL microcentrifuge tubes):ReagentControl Tube (µL)Test Tube (µL)Boiled Sample500Sample (supernatant)050ReagentⅠ200200ReagentⅡ50503.3 Mix thoroughly. Incubate in a 25°C water bath for 10 minutes, then immediately transfer to a boiling water bath for 10 minutes. After mixing, centrifuge at 5,000 g, 25°C for 10 minutes. Collect the supernatant. Transfer 200 µL of the supernatant to a micro glass cuvette or 96-well plate. Measure the absorbance of both the Test tube and Control tube at 410 nm. Calculate ΔA = Atest - Acontrol.Note:Each test tube requires a corresponding control tube.It is recommended to perform a preliminary test with 2-3 samples expected to have significant differences before the formal experiment.The optimal reaction temperature for PPO may vary slightly among different samples and can be adjusted between 25-37°C.If the sample absorbance is less than 0.02, consider increasing the sample volume appropriately. If the sample absorbance is greater than 1, it is advisable to dilute the sample before assay.4. Calculation of ResultsNote: We provide both the derived formula and a simplified formula. They are equivalent. It is recommended to use the simplified formula in bold for final calculation.4.1 Calculation Formula when using a 96-well plate:Unit Definition: One unit of enzyme activity is defined as the amount that causes a change of 0.005 in absorbance at 410 nm per minute per gram of tissue per mL of reaction mixture.PPO Activity (U/g fresh weight) = ΔA × Vtotal reaction÷ (W × Vsample / Vtotal sample ) ÷ 0.005 ÷ T = 120 × ΔA / W4.2 Calculation Formula when using a micro glass cuvette:Unit Definition: One unit of enzyme activity is defined as the amount that causes a change of 0.01 in absorbance at 410 nm per minute per gram of tissue per mL of reaction mixture.PPO Activity (U/g fresh weight) = ΔA × Vtotal reaction ÷ (W × V sample / Vtotal sample ) ÷ 0.01 ÷ T = 60 × ΔA / WParameter Definitions:Vtotal reaction: Total volume of the reaction system (0.3 mL)Vsample : Volume of sample added to the reaction (0.05 mL)Vtotal sample : Volume of Extraction Buffer added during homogenization (1 mL)T: Reaction time (10 minutes)W: Sample weight (g)PrecautionsThis product is for research use only. Not for use in clinical diagnosis. For your safety and health, please wear lab coats and disposable gloves during operation... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Product introduction：Dualucif The firefly & Renilla assay kit (dual luciferase reporter assay kit) provides an effective means to detect the expression of genes. In DLR detection, the activities of firefly luciferase and Renilla luciferase can be detected in a single sample in turn. FirstProduct introduction：Dualucif The firefly & Renilla assay kit (dual luciferase reporter assay kit) provides an effective means to detect the expression of genes. In DLR detection, the activities of firefly luciferase and Renilla luciferase can be detected in a single sample in turn. First, luciferin was used as substrate to detect the activity of firefly luciferase, then substances inhibiting the catalysis of firefly luciferase were added, and coelenterazine was added to detect the activity of Renilla luciferase to achieve dual luciferase reporter gene detection. The bioluminescence system of luciferase and its substrate can detect gene expression very sensitively and efficiently. Usually, the transcriptional regulatory element or 5'promoter region of the gene of interest is cloned upstream of luciferase, or the 3'-utr region is cloned downstream of luciferase to construct a reporter gene plasmid, and then transfect the cells. After the cells are treated with appropriate drugs, the cells are lysed, and the transcriptional regulation effect of drug treatment on the target gene is judged by detecting the luciferase activity. Renilla luciferase is more often used as an internal reference for detecting transfection efficiency to eliminate the difference in cell number and transfection efficiency. Firefly luciferase is a protein with a molecular weight of about 61 kDa. In the presence of ATP, magnesium ions and oxygen, it can catalyze the production of oxyluciferin from luciferin. In the process of luciferin oxidation, it will produce a light signal. Renilla luciferase is a protein with a molecular weight of about 36 kDa. In the presence of oxygen, it can catalyze the oxidation of coelenteramide to coelenteramide, and also produce light signals in the process of coelenteramide oxidation. The optical signal of this kit can be measured by chemiluminescence instrument, microplate reader or liquid scintillation tester. The kit has the characteristics of rapid detection, high sensitivity, wide detection range and no interference of cell endogenous activity.Instruction：1.Cell lysis ( 1 ) Remove the medium and gently wash twice with PBS ( adherent cells can be operated directly, suspension cells need to be centrifuged to collect cells ). Add 1 × Lysis Buffer ( diluted component A with sterile water at 4 : 1 ) according to the following scheme, and then place the culture plate on a micro-oscillator at room temperature for 15 min to fully lyse the cells. Note : The pyrolysis products can be stored at room temperature for 6 h, and can be stored at − 70 °C for a long time ( the pyrolysis products cannot be repeatedly frozen and thawed ). ( 2 ) The pyrolysis products were centrifuged at 10000-15000 rpm for 3-5 min. After centrifugation, the supernatant was transferred into a new EP tube for subsequent detection. Note : Cells can be detected immediately after lysis, or frozen, and re-detected when needed. The frozen samples need to be thawed to room temperature for detection. 2. Preparation of working fluid ( 1 ) Restore all components to room temperature. ( 2 ) Dilute component C with component B to 0.2 mg / mL firefly luciferase working solution. Note : The firefly luciferase working solution cannot be repeatedly frozen and thawed. If the amount of a single experiment is small, it is recommended to be subpackaged into small specifications according to a single amount of use. ( 3 ) The E component was diluted into the renilla luciferase working solution with the D component, and the dilution method was 1 µL E component was added to the 49 µL D component. Note : Renilla luciferase working solution needs to be prepared now. 3.chemiluminescence value detection ( 1 ) According to the operation instructions of the instrument, the instrument with chemiluminescence detection function was opened, such as multifunctional microplate reader. The parameters were set, the determination time was 10 s, and the determination interval was 2 s. ( 2 ) each sample determination, take the sample 20-100 µL ( if the sample volume is enough, please add 100 µL ; if the sample amount is insufficient, the amount can be appropriately reduced, but the amount of detection holes needs to be consistent ). 1 × Lysis Buffer was blank control. ( 3 ) 100 µL firefly luciferase working solution was added to determine the RLU ( relative light unit ) value ( it is recommended that the microplate reader set up the Shaking mixing function ). Note : Since the luminescence is instantaneous, it is recommended to detect immediately after adding the firefly luciferase working solution. ( 4 ) 100 µL renilla luciferase working solution was added to determine the RLU ( relative light unit ) value ( Shaking mixing function is recommended for microplate reader ). ( 5 ) In the case of renilla luciferase as an internal reference, the RLU value measured by firefly luciferase was divided by the RLU value measured by renilla luciferase. According to the obtained ratio, the activation degree of the target reporter gene between different samples was compared. If firefly luciferase is used as an internal reference, similar calculations can also be performed.Component：Recommendation：It is recommended to use component B in advance to prepare 2 mg / mL storage solution, component B, component D and component C prepared as storage solution, and to carry out small batch packing according to the experimental requirements. All test working fluids are recommended to be used now to avoid repeated freezing and thawing.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. in order to obtain the best determination effect, when using a single tube chemiluminescence instrument for determination, the time from the mixing of sample and determination reagent to the pre determination should be controlled as much as possible; When using a multi-functional fluorescent microplate reader with chemiluminescence detection function, it is advisable to add all samples first, and then uniformly add firefly luciferase detection reagent. 3. the strongest wavelength of firefly luciferase catalyzed bioluminescence is 560 nm, and the strongest wavelength of Renilla luciferase catalyzed bioluminescence is 480 nm. 4. to prevent interference between holes, it is recommended to use white opaque orifice plate. 5. due to the influence of temperature on enzyme reaction, the sample and reagent should be measured after reaching room temperature. 6. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Study on gene expression regulation and promoter... Read More | Hydrogen peroxide, a reactive oxygen species produced through the metabolism of molecular oxygen, serves as both an intracellular signaling messenger and a source of oxidative stress. Hydrogen peroxide is generated in cells via multiple mechanisms such as the NOX-mediated ROS production by Hydrogen peroxide, a reactive oxygen species produced through the metabolism of molecular oxygen, serves as both an intracellular signaling messenger and a source of oxidative stress. Hydrogen peroxide is generated in cells via multiple mechanisms such as the NOX-mediated ROS production by neutrophils and macrophages (respiratory burst) or by the dismutase of superoxide anions produced as a result of electron leak during mitochondrial respiration. Abnormal hydrogen peroxide production contributes to oxidative cell damage and the progression of diseases such as asthma, atherosclerosis, osteoporosis, and neurodegeneration.Intracellular hydrogen peroxide assay kit has been used to measure intracellular hydrogen peroxide levels... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |