| Description | Inquire | Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm.Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm. In the early stage of apoptosis, different types of cells will turn phosphatidylserine out to the cell surface and expose to the extracellular environment. At this time, using Annexin V labeled with fluorescent protein PE, that is, Annexin V-PE, combined with phosphatidylserine ( PS ), the eversion of phosphatidylserine, an important feature of apoptosis, can be directly detected by flow cytometry. Normal cells will not be stained by Annexin V-PE, apoptotic or necrotic cells will be stained by Annexin V-PE. Annexin V-PE can be used in combination with partially non-permeable nuclear dye ( 7-AAD / PI ) to distinguish cells at different stages of apoptosis. RedNucleus II provided in this kit is a far-red dye that belongs to an anthraquinone compound and cannot penetrate the intact cell membrane of living cells and early apoptotic cells. It is non-permeable, but can quickly stain the nucleus / dsDNA in dead and permeable cells. RedNucleus II is an ideal substitute for propidium iodide ( PI ) and 7-AAD.Combined with Annexin V-PE, it has better spectral characteristics without compensation regulation : it is not excited by ultraviolet light and does not overlap with PE / PE homologues, so it can be combined with FITC, PE and purple fluorescent dyes for multicolor analysis. When combined with Annexin V-PE, RedNucleus II was excluded from living cells and early apoptotic cells, while late apoptotic cells and dead cells were double-positive for Annexin V-PE and RedNucleus II. Annexin V-PE / RedNucleus II apoptosis detection kit can be detected by flow cytometry or other fluorescence detection equipment. Components: Components A598354(10T) A598354(50T) A598354(100T) A. 1×Annexin V Combining buffer solution 10 mL 50 mL 50 mL×2 B. Annexin V-PE 50 µL 250 µL 500 µL C. RedNucleus II 100 µL 500 µL 1 mLProduct parameters：Annexin v-pe:ex/em=488/578 nmrednucleus ii:ex/em=635/695 NMUsage method:1. Experimental design: Blank tube: Negative control group cells, without Annexin V-PE/RedNucleus II. Used to regulate voltage.Single staining tube: Positive control group cells were treated with Annexin V-PE alone/RedNucleus II alone. Used for adjusting compensation.Detection tube: Add Annexin V-PE/RedNucleus II to the processed cells. After adjusting the voltage compensation using blank tubes and single dye tubes, obtain the required flow data.2. Collect cells(1) For suspended cells:a. After inducing cell apoptosis, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS, and count them.Note: PBS resuspension cannot be omitted. The process of PBS resuspension also serves to wash cells, ensuring the subsequent binding of Annexin V-PE.b. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. c. Add 5 µ L Annexin V-PE and mix gently.d. Add 5 µ L of RedNucleus II staining solution and mix gently.e. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.(2) For adherent cells:a. Suck out the cell culture medium into a suitable centrifuge tube, wash the adherent cells with PBS once, and add an appropriate amount of trypsin cell digestion solution (without EDTA) to digest the cells. Incubate at room temperature until gently blowing can remove the trypsin cell digestion solution when the adherent cells are blown down. Overdigestion of pancreatic enzymes should be avoided.Note: For adherent cells, the trypsin digestion step is crucial. If the trypsin digestion time is too short, cells need to be blown hard to detach, which can easily cause damage to the cell membrane and lead to false positives of cell necrosis; If the digestion time is too long, it can also cause cell membrane damage and false positives of cell necrosis, and even affect the binding of phosphatidylserine and Annexin V-PE on the cell membrane, thereby interfering with the detection of cell apoptosis.b. Add the cell culture medium collected in the previous step, gently blow down the cells, transfer them to a centrifuge tube, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS and count them.Note: Adding the cell culture medium from the previous step is very important. On the one hand, it can collect cells that have already been suspended and undergone apoptosis or necrosis. On the other hand, the serum in the cell culture medium can effectively inhibit or neutralize residual trypsin. The residual trypsin will digest and degrade the subsequently added Annexin V-PE, leading to staining failure.c. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. d. Add 5 µ L Annexin V-PE and mix gently.e. Add 5 µ L of RedNucleus II staining solution and mix gently.f. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.3. Result analysis:(1) Flow cytometry detection:a. After incubation, 400 µ L of 1 × Annexin V binding buffer can be directly added to resuspend the cells, and immediately detected on the machine. Annexin V-PE is excited by 488 nm/566 nm laser, and the fluorescence emission spectrum is detected at 578 nm (BL2 (FL2)/YL1 channel), while the RedNucleus II channel emission spectrum is approximately at 695 nm (RL1 (FL4) channel).b. On the scatter plot of the bivariate flow cytometer, live cells are shown in the lower left quadrant, which is (Annexin V-PE -/RedNucleus II -); The lower right quadrant represents early apoptotic cells, which are (Annexin V-PE+/RedNucleus II -); The upper right quadrant represents necrotic and late stage apoptotic cells, which are (Annexin V-PE+/RedNucleus II+); The upper left quadrant displays naked nuclear cells, which are (Annexin V-PE -/RedNucleus II+).(2) Fluorescence microscopy detection:a. Centrifuge at 1000 rpm for 5 minutes, collect cells, and gently resuspend them in 400 µ L of 1 × Annexin V binding buffer. Transfer the cells to a 96 well plate and settle for a moment or perform cell smear, then observe under a fluorescence microscope.b. Annexin V-PE is compatible with PE filters. RedNucleus II can use a far red long pass filter.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. to reduce the process of apoptosis, the incubation process can be operated on ice, but the incubation time should be extended to at least 30 min. 3. as apoptosis is a rapid process, it is recommended that samples be analyzed within 1 h after staining. 4. for adherent cells, digestion is a key step. If there are floating cells when adherent cells induce apoptosis, the floating cells and adherent cells should be collected and stained. Handle adherent cells with care to avoid artificial damage to cells. The trypsin digestion time is too short, and the cells need to be blown hard to fall off, which is easy to cause damage to the cell membrane and excessive intake of rednucleus II; If the digestion time is too long, the cell membrane is also prone to damage, and even affect the binding of phosphatidylserine and annexin v-pe on the cell membrane. When digesting, spread pancreatin on the bottom of the well plate, fully contact the pancreatin with the cells when shaking gently, then pour out most of the pancreatin, use the remaining small amount of pancreatin to digest for a period of time, and terminate when the gap between cells increases and the bottom of the bottle is spotted. Try not to use EDTA in the digestive juice, which will affect the binding of annexin V to PS. 5. after the adherent cells are digested with trypsin, it is recommended to stain after recovering in the optimal culture conditions and medium for about 30 min to avoid false positives. 6. in order to avoid losing cells when washing cells, you can use a large tip over a small tip to aspirate. 7. the optimal concentration of dye is determined by the specific experimental requirements. 8. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 9. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Early apoptosis detection, annexin V Kit... Read More | Product content:M665754Component25 TStorageM665754ATris-HCl, 1 mM, PH 8.01 mL-20℃. Avoid freeze/thaw cycleM665754BE. coli Poly(A) Polymerase, 5 U/µL15 µL-20℃. Avoid freeze/thaw cycleM665754C10×Poly(A) Polymerase Buffer80 µL-20℃. Avoid freeze/thaw Product content:M665754Component25 TStorageM665754ATris-HCl, 1 mM, PH 8.01 mL-20℃. Avoid freeze/thaw cycleM665754BE. coli Poly(A) Polymerase, 5 U/µL15 µL-20℃. Avoid freeze/thaw cycleM665754C10×Poly(A) Polymerase Buffer80 µL-20℃. Avoid freeze/thaw cycleM665754DATP, 10 mM15 µL-20℃. Avoid freeze/thaw cycleM665754ERT Primer, 25 µM90 µL-20℃. Avoid freeze/thaw cycleM665754F5×SuperRT Buffer120 µL-20℃. Avoid freeze/thaw cycleM665754GUltraPure dNTP Mix, 10 mM each30 µL-20℃. Avoid freeze/thaw cycleM665754HSuperRT, 200 U/µL15 µL-20℃. Avoid freeze/thaw cycleM665754IRNase-Free Water1 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kit uses the method of adding a poly (A) tail at the 3 'end of miRNA to give miRNA a Poly (A) tail, followed by reverse transcription using Oligo (dT) - Universal tag universal reverse transcription primers to synthesize the first stranded cDNA corresponding to miRNA. The miRNA cDNA first strand synthesis kit contains all the reagents required for the miRNA 3 'end Poly (A) tail modification process and the reverse transcription process after modification. This kit has a very high Poly (A) modification and reverse transcription efficiency, which can range from 1 ng-2 µ The first strand of cDNA corresponding to miRNA was effectively obtained from the total RNA of g. And the operation is simple and fast, which can be used to simultaneously detect multiple miRNAs from a synthesized cDNA reaction. This not only reduces errors and saves samples, but also achieves high-throughput detection.Note: This kit must be used in conjunction with the miRNA fluorescence quantitative detection kit.Self prepared experimental materials: 1 ng-2 µ Total RNA of g, or 0.1 ng-1 µ Small molecule RNA of g.Notes:To prevent RNase pollution, attention should be paid to the following aspects:1. Use plastic products and gun heads without RNase to avoid cross contamination.2. Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use. Plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3. The solution should be prepared using water without RNase.4. Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.Usage:A. The process of miRNA adding Poly (A) tail:1.based on the amount of RNA used, dilute the total RNA of 10 mM ATP with 1 mM Tris (pH 8.0) according to the following formula: ATP dilution coefficient=5000/__ ngExample: If the initial amount of total RNA is 100 ng, then the ATP dilution coefficient is 5000/100=50. About to dilute ATP 50 times (1 µ 10 mM ATP plus 49 for l µ 1 mM Tris at pH 8.0.2. Add the following reagents to the pre cooled RNase free reaction tube in the ice bath to a total volume of 25 µ L. reagent 25 µlReaction system final concentration total RNA* X µl Up to 2 µg 10×Poly(A) Polymerase Buffer 2.5 µl 1× Diluted ATP in step "1" 1 µl / E. coli Poly(A) Polymerase, 5U/µl 0.5 µl 2.5 U RNase-Free Water up to 25 µl /*The total RNA used in the reaction must contain small molecule RNA.This process can also directly use small molecule RNA (recommended dosage of 2-5) µ L. Please determine the amount added based on the abundance of the target miRNA.3. Gently mix the above reaction solution and briefly centrifuge to collect the liquid at the bottom of the tube. Incubate at 37 ℃ for 15 minutes. After this process is completed, immediately proceed with the synthesis of the first strand cDNA or temporarily store it at -20 ℃. If long-term storage is required, it is recommended to store at -80 ℃.B. The process of synthesizing the first strand of modified miRNA cDNA:1. Add the reagents in the table below to the pre cooled RNase free reaction tube in the ice bath until the final volume reaches 20µl: reagent 20 µlReaction system The above Poly (A) reaction solution 4 µl UltraPure dNTP Mix ，10 mM each 1 µl RT Primer ，25 µM 3 µl 5×SuperRT Buffer 4 µl SuperRT ，200 U/µl 0.5 µl RNase-Free Water 7.5 µl2. Gently mix the above reaction solution and briefly centrifuge to collect the liquid at the bottom of the tube. Incubate at 42 ℃ for 50 minutes.3.85 ℃ for 5 minutes and terminate the reaction. The synthesized cDNA reaction solution can be directly used for fluorescence quantitative detection experiments or stored at -20 ℃ for future use... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The commonly used method of eukarYOtic gene expression regulation research is the detection of reporter genes, and bioluminescence is the most commonly used and effective means of reporter gene detection. Luciferase can catalyze the conversion of the substrate luciferin and emit photons. This The commonly used method of eukarYOtic gene expression regulation research is the detection of reporter genes, and bioluminescence is the most commonly used and effective means of reporter gene detection. Luciferase can catalyze the conversion of the substrate luciferin and emit photons. This product provides a rapid, sensitive and stable detection method for the expression of Renilla luciferase reporter gene in mammalian cells. Product characteristic：1.Rapid : Cell lysis was completed within 10-15 min ；2.Convenience : The reagent is easy to prepare, and the sample detection steps are simple；Instruction：1. Cell lysis ( 1 ) Remove the culture medium and gently wash with PBS ( adherent cells can be directly performed this operation, suspension cells should be centrifuged to collect cells ). Add 1 × Lysis Buffer ( diluted component A with sterile water at 4 : 1 ) according to the following scheme, and then place the culture plate on a micro-oscillator at room temperature for 15 min to fully lyse the cells. Note : The pyrolysis products can be stored at room temperature for 6 h, and can be stored at − 70 °C for a long time ( the pyrolysis products cannot be repeatedly frozen and thawed ). ( 2 ) The pyrolysis products after full pyrolysis were centrifuged at 10000-15000 rpm for 3-5 min. After centrifugation, the supernatant was moved into a new EP tube for subsequent detection. 2. Preparation of working fluid ( 1 ) Restore all components to room temperature. ( 2 ) Dilute component C into renilla luciferase working solution with component B, and the dilution method is to add 1 µL C component to 49 µL B component. 3.chemiluminescence value detection ( 1 ) According to the operation instructions of the instrument, the instrument with chemiluminescence detection function was opened, such as multifunctional microplate reader. The parameters were set, the determination time was 10 s, and the determination interval was 2 s. ( 2 ) The cell lysis products were added to the measuring tube according to the volume of 20 ~ 100 µL ( keep the same amount of samples each time ). 1 × Lysis Buffer was blank control. ( 3 ) 100 µL renilla luciferase working solution was added to determine the RLU ( Relative light unit ) value ( Shaking mixing function is recommended for microplate reader ). Note : The renilla luciferase working solution cannot be stored for a long time. It is now ready for use and is used once. Component：RenillaLuciferase Lysis Buffer；RenillaLuciferase Assay Buffer；CoelenterazineMatters needing attention：Scope of application： Matters needing attention：1.Please instantaneously centrifuge the product to the bottom of the tube before use, and then carry out subsequent experiments ; 2.Due to the influence of temperature on the enzyme reaction, the sample and reagent should be measured after reaching room temperature. 3.The strongest wavelength of bioluminescence catalyzed by renilla luciferase is 480 nm, in order to prevent interference between holes, it is recommended to use white opaque orifice plate ;4. B component is recommended to carry out small batch packing according to the experimental requirements ; 5.It is recommended to use it now to avoid repeated freezing and thawing ; 6.For your safety and health, please wear experimental clothes and wear disposable gloves. Scope of application：Study on gene expression regulation and promoter... Read More |