| Description | Annexins are a family of calcium-dependent phospholipid-binding proteins that preferentially bind phosphatidylserine (PS). Under normal physiologic conditions, PS is predominantly located in the inner leaflet of the plasma membrane. Upon initiation of apoptosis, PS loses its asymmetric Annexins are a family of calcium-dependent phospholipid-binding proteins that preferentially bind phosphatidylserine (PS). Under normal physiologic conditions, PS is predominantly located in the inner leaflet of the plasma membrane. Upon initiation of apoptosis, PS loses its asymmetric distribution across the phospholipid bilayer and is translocated to the extracellular membrane leaflet marking cells as targets of phagocytosis. Once on the outer surface of the membrane, PS can be detected by fluorescently labeled Annexin V in a calcium-dependent manner. In early-stage apoptosis, the plasma membrane excludes viability dyes such as 4',6-diamidino-2-phenylindole （DAPI）, propidium iodide (PI), 7-AAD. These cells will stain with Annexin V but not a viability dye, thus distinguishing cells in early apoptosis. However, in late stage apoptosis, the cell membrane loses integrity thereby allowing Annexin V to also access PS in the interior of the cell. A viability dye can be used to resolve these late-stage apoptotic and necrotic cells (Annexin V, viability dye-positive) from the early-stage apoptotic cells (Annexin V positive, viability dye-negative). This kit is suitable for the identification and enumeration of dead cells, such as apoptotic or necrotic cells, by flow cytometry.A1456541Components20 T50 T100 TStorageQuantity Per TestA1456541A10× Annexin V Binding Buffer5 mL10 mL20 mL2-8℃200 µL per 0.5-1.0 × 10⁵ cellsA1456541BAnnexin V -PE-Cy7200 µL500 µL1000 µL2-8℃. Store in the dark.10 µL per 0.5-1.0 × 10⁵ cellsA1456541CDAPI Staining Solution (25 µg/mL)20 µL50 µL100 µL2-8℃. Store in the dark.1 µL per 0.5-1.0 × 10⁵ cellsNote: The recommended number of cells to stain per test is 0.5-1.0 × 10⁵ cells.Precautions1. Please try to avoid light when using to slow down the quenching of fluorescence.2. DAPI Solution is toxigenic and mutagenic; handle with care.3. Due to the calcium dependence of the Annexin V:PS interaction, it is critical to avoid buffers containing EDTA or other calcium chelators during Annexin V experiments.Instruction for use 1. Dilute 10X Binding Buffer to 1X using distilled water (1 mL 10X Binding Buffer + 9 mL ddH2O).2. Wash cells twice with cold PBS and then resuspend the desired amount of cells in Annexin V Binding Buffer at a concentration of 0.5-1.0x 10⁶ cells /mL. 3. Add 10 µL of Annexin V-PE-Cy7 and 1 µL of DAPI staining solution to 100 µL of cell suspension.4. Add 100 µL of 1x Binding Buffer to each assay. Gently vortex the cells and incubate for 10 min at RT (25°C) in the dark.5. Perform flow cytometry analysis within 1 hr... Read More | Product introduction：Used to isolate lymphocytes from human organsMatters needing attention：1. samples, reagents and experimental environment in the whole process shall be carried out at 20 ± 2 ℃. In order to obtain the best experimental results, it is best to carry out the Product introduction：Used to isolate lymphocytes from human organsMatters needing attention：1. samples, reagents and experimental environment in the whole process shall be carried out at 20 ± 2 ℃. In order to obtain the best experimental results, it is best to carry out the experiment within 2 h of sampling. The longer the sample is stored, the worse the cell separation effect is. The separation effect is even worse after the sample is placed for more than 6 h, or even cannot achieve the purpose of separation. 2. in this experiment, it is better not to use plastic products with high polymerization materials (such as polystyrene), but use non-static, low static ionization heart tubes and glass products without alkali treatment, because the electrostatic effect will lead to cell adhesion, and the surface of alkali treated glass will become rough, which will affect the effect of cell separation. 3. aspirating too many lymphocyte layers and separation liquid layers will cause the granulocytes at the junction of separation liquid to be aspirated, thus increasing the number of mixed granulocytes. 4. when the amount of separating solution is greater than that of tissue single cell suspension sample, the separation effect is better.Scope of application：Lymphocyte isolation... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire | Vitamins Kit is a multivitamin mix comprising biotin, folic acid, vitamin B6, riboflavin, thiamine, D-pantothenic acid and niacinamide.Vitamins Kit has been used as a vitamin supplement in the minimal medium for conidia spores and vegetative cultures |