| Description | Inquire | DescriptionThe Baran Late-Stage Toolkit is a convenient collection of 12 highly innovative reagents that are highly effective in the diversification of complex molecules. The contents in the box are 11 Baran Diversinates™and one vial of Palau′Chlor®in amounts of 100 mg each. For DescriptionThe Baran Late-Stage Toolkit is a convenient collection of 12 highly innovative reagents that are highly effective in the diversification of complex molecules. The contents in the box are 11 Baran Diversinates™and one vial of Palau′Chlor®in amounts of 100 mg each. For obtaining larger amounts of any desired kit component, see the kit component table at the bottom of the page.Useful Topics:Late Stage FunctionalizationBaran Group – Professor Product PortalPalau′ChlorDiversinates... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL R669988 Component 50T Storage R669988A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. R669988B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. R669988C Buffer RL 35 mL RT R669988D Buffer RLC 35 mL RT R669988E Buffer RW1 40 mL RT R669988F Buffer RW2 (concentrate) 11 mL RT R669988G RNase-Free Water 10 mL RT R669988H Spin Columns FL with Collection Tubes 50 sets RT R669988I Spin Columns RM with Collection Tubes 50 sets RT R669988J RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RTProductsThis kit is used for the extraction and purification of high-quality total RNA from a variety of plants, and is also suitable for the extraction of fungal mycelial RNA. The unique separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while the silicon matrix membrane is used to adsorb the RNA for purification, so that various contaminants, such as polysaccharides, are effectively removed by washing, and the eluted RNA can be directly used in various downstream experiments. The molecular weight of RNA extracted by this kit is more than 200 bases, with high purity and almost no DNA residue. For RNA experiments that are very sensitive to trace DNA, the residual DNA can be removed by digestion on a column using RNase-free DNase. The extracted RNA can be used in Northern Blot, Dot Blot, RT-PCR and in vitro translation experiments.Self-contained reagents: β-mercaptoethanol, anhydrous ethanol (freshly opened or for RNA extraction).Pre-experiment Preparation and Important Notes1. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.2) RNase-free water should be used to prepare the solution.(3) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.2. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips to avoid cross-contamination.(2) Glassware should be dry-roasted at 180°C for 4 hours before use, and plasticware can be soaked in 0.5M NaOH for 10 minutes, rinsed thoroughly with water and autoclaved.3) RNase-free water should be used to prepare the solution.(4) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.3. Avoid repeated freezing and thawing of the extracted samples, otherwise it will affect the amount and quality of RNA extraction.4. Please add β-mercaptoethanol to Buffer RL before use, add 10µl of β-mercaptoethanol to 1ml of Buffer RL, it can be stored for 1 month at room temperature. Buffer RL with β-mercaptoethanol can be stored at room temperature for 1 month. β-mercaptoethanol is not required for use of Buffer RLC.5. Anhydrous ethanol should be added to Buffer RW2 before first use according to the instructions on the reagent bottle label.6. If precipitation occurs in Buffer RL and Buffer RLC, heat to dissolve and leave at room temperature.7. All centrifugation steps are carried out at room temperature and all steps are performed quickly. Procedure1. 50-100 mg of plant tissue is quickly ground to a powder in liquid nitrogen and added to 600 µl of Buffer RL (check for addition of β-mercaptoethanol before use) or Buffer RLC. vortexing and oscillating to allow for adequate lysis.Note: 1) The main component of Buffer RL is guanidine isothiocyanate, which is suitable for lysis of most plant tissues. However, in some plant tissues (e.g. endosperm of corn), due to the special secondary metabolites, guanidine isothiocyanate causes precipitation of the sample, resulting in poor RNA extraction, in this case, Buffer RLC can be added instead of Buffer RL.2) Incubation at 56°C for 1-3 minutes helps tissue lysis, but do not incubate at high temperatures for plants with high starch content.2. Transfer all the liquid obtained in step 1 to an adsorption column (Spin Columns FL) that has been loaded into a collection tube, centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, and transfer the supernatant from the collection tube to a new centrifuge tube (supplied).Note: 1) The tip of the tip of the gun can be cut off when aspirating liquids to facilitate sampling.2) Spin Columns FL removes most of the debris, but a small portion will still flow out and a precipitate will form in the collection tube after centrifugation, so be careful to avoid aspirating the precipitate when proceeding to the next step.3. Add 0.5 times the volume of anhydrous ethanol to the clean lysate obtained in step 2 and mix rapidly.Note: Precipitation may occur upon addition of ethanol, but does not affect subsequent tests.4. Transfer the solution obtained in the previous step to the Spin Columns RM in the collection tube. If it is not possible to add all of the solution to the column at one time, centrifuge the column at 12,000 rpm for 15 seconds in two batches, discard the waste solution and put the column back into the collection tube.5. Add 350 µl Buffer RW1 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid and put the adsorbent column back into the collection tube.6. Preparation of DNase I mixture: Take 52µl of RNase-Free Water, add 8µl of 10×Reaction Buffer and 20µl of DNase I (1U/µl) to it, mix well, and make a final volume of 80µl of reaction solution.7. Add 80µl of DNase I mixture directly to the adsorption column and incubate at 20-30°C for 15 minutes.8. Add 350 µl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid and put the column back into the collection tube.9. Add 500 µl of Buffer RW2 to the column (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 15 seconds, and discard the waste solution.10. Repeat step 9.11. Place the adsorbent column back into the collection tube, centrifuge at 12,000 rpm for 1 minute, and allow the column to come to room temperature for a few minutes to thoroughly dry out the anhydrous ethanol in the adsorbent column.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (zymography, PCR, etc.).12. Load the adsorption column into a new centrifuge tube, add 30-50 µl of RNase-Free Water to the middle of the adsorbent membrane, leave it at room temperature for 1 minute, centrifuge at 12,000 rpm for 1 minute, and store the resulting RNA solution at -70°C to prevent degradation.Note: 1) The volume of RNase-Free Water should not be less than 30 µl, too small volume affects the recovery rate.2) If you want to increase the RNA yield, repeat step 12 with 30-50 µl of fresh RNase-Free Water.3) If the RNA concentration is to be increased, the resulting solution can be reintroduced into the adsorption column and step 12 repeated... Read More | Product contentU665751Component100 TStorageU665751A2×UltraSYBR One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751BUltraSYBR One Step EnzymeMix50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751C50×High ROX50 µL-20℃. AvoidProduct contentU665751Component100 TStorageU665751A2×UltraSYBR One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751BUltraSYBR One Step EnzymeMix50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751C50×High ROX50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751DRNase-Free Water1.5 mL-20℃. Avoid freeze/ Thaw cycle. Product Introduction This product is a specialized kit for one-step Real-Time RT-qPCR. The SYBR Green I fluorescent dye contained can bind to all double-stranded DNA, allowing this product to be used for the detection of many different target sequences without the need to synthesize specific labeling probes. Real Time RT-qPCR reaction using this product, reverse transcription and quantitative PCR are carried out in the same reaction system, there is no need to add reagents during the reaction, no need to open the cap of the tube, avoiding contamination while improving the efficiency of the experiment. The new high-efficiency reverse transcriptase RNase H is activity-deficient, which reduces the degradation of RNA in the reverse transcription reaction. The enzyme has high reverse transcription efficiency and can perform a good reverse transcription reaction on a small amount of RNA template. It has high affinity to RNA and can read through RNA templates with high GC content and complex secondary structure. New efficient hot start enzyme, the enzyme activity is closed at room temperature, thus effectively avoiding non-specific amplification caused by non-specific binding of primers and templates or primer dimerization at room temperature, which greatly improves the accuracy of fluorescence quantitative PCR reaction. The included buffer system maximizes the efficacy of both enzymes at the same time and improves efficiency. This product has high sensitivity, high specificity, wide linear range, and more accurate quantification of target genes.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used with Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument. Instruments that do not require ROX calibration (U665567) Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96 and others. Instruments that require High ROX calibration (U665751) ABI Prism 7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, and others.matters needing attention1. Before using the reagents in this kit, please mix them gently by turning them up and down to avoid foaming as much as possible, and use them after brief centrifugation.2. This product uses RNA as the template for one-step RT-PCR experiment, RNase contamination should be avoided during operation, it is recommended to operate RNA in a special area, use special instruments and consumables, the operator with a mask and disposable gloves and often change the gloves, the experiment-related consumables should be processed with 0.1% DEPC (diethyl ether of pyrocarbonate) aqueous solution at 37℃ for 12 hours and autoclaved for 30 minutes before use. Sterilize for 30 minutes before use.3. UltraSYBR One Step RT-qPCR Buffer contains SYBR Green I fluorescent dye. Avoid bright light when storing this product or preparing PCR reaction solutions.4. Repeated freezing and thawing of each reagent in this kit should be avoided; repeated freezing and thawing may degrade the product performance. This product can be stored for a long time at -20℃, protected from light. If frequent use is required in the short term, it can be stored at 2-8℃.5. This kit must use specific primers, the choice of primers can be selected according to specific experiments, the good or bad primer design directly affects the results of RT-PCR reaction, the design of primers need to consider the GC content, primer length, primer position, the secondary structure of the PCR product and other factors, it is recommended to use a professional primer design software for design.6. This product cannot be used for fluorescent quantitative PCR by the probe method.Usage1. Dissolve RNA template, primers, 2× UltraSYBR One Step Buffer, UltraSYBR One Step EnzymeMix and RNase-Free Water and set aside on ice.2. PCR reaction system:Reagents25 µl Reaction systemFinal concentration2×UltraSYBR One Step Buffer12.5 µl1×Forward Primer，10 µM0.5 µl0.2 µM¹⁾Reverse Primer，10 µM0.5 µl0.2 µM¹⁾UltraSYBR One Step EnzymeMix0.5 µl RNA TemplateX µl10 pg – 100 ng50×Low ROX or High ROX（optional）2）0.5 µl1×RNase-Free Waterup to 25 µlNote: 1) Usually, the primer concentration of 0.2µM can get better results, and the final concentration of 0.1-0.5µM can be used as a reference for setting the range. If the amplification efficiency is not high, the concentration of primer can be increased; when non-specific reaction occurs, the concentration of primer can be decreased, thus optimizing the reaction system.(2) The excitation optical system varies from instrument to instrument, choose to add 50×Low ROX or 50×High ROX according to the instrument using fluorescence quantification.3. Vortex and shake to mix, centrifuge briefly, and collect the solution at the bottom of the tube.4. RT-qPCR reaction conditions (fluorescence quantitative PCR is a two-step method), this program is based on the ABI 7500 fluorescence quantitative PCR instrument as an exampleNote: 1) It is recommended to use two-step PCR reaction program, if you improve the reaction specificity, you can increase the annealing temperature to 60-64 ℃ as a reference for the setting range; if you do not get good experimental results due to the use of primers with lower Tm values, etc., you can try to carry out three-step PCR amplification.(2) For melting curve analysis, please set up the program recommended by the fluorescence quantitative PCR instrument used, and this program is set up with the ABI 7500 fluorescence quantitative PCR instrument as a reference.RT-qPCR reaction conditions (fluorescence quantitative PCR was a three-step method):Note: 1) For three-step PCR amplification, please use the range of 56℃-64℃ as the setting reference for the annealing temperature.(2) For melting curve analysis, please set up the program recommended by the fluorescence quantitative PCR instrument you are using, this program is ABI750 fluorescent quantitative PCR instrument as a reference setting... Read More |