| Description | Phosphoenolpyruvate Carboxykinase (PEPCK, EC 4.1.1.32) is widely present in animals, plants, microorganisms, and cells. It catalyzes the conversion of oxaloacetate to phosphoenolpyruvate and is a key regulatory enzyme in the gluconeogenesis pathway.Assay PrinciplePEPCK catalyzes the conversion of Phosphoenolpyruvate Carboxykinase (PEPCK, EC 4.1.1.32) is widely present in animals, plants, microorganisms, and cells. It catalyzes the conversion of oxaloacetate to phosphoenolpyruvate and is a key regulatory enzyme in the gluconeogenesis pathway.Assay PrinciplePEPCK catalyzes the conversion of Oxaloacetate to Phosphoenolpyruvate and CO₂. Pyruvate Kinase and Lactate Dehydrogenase subsequently catalyze the sequential oxidation of NADH to NAD⁺. The rate of decrease in NADH absorbance at 340 nm is measured, which reflects PEPCK activity.Component100TStorageExtraction Buffer100 mL2-8℃Reagent 118 mL2-8℃Reagent 216.5 µL2-8℃Reagent 31EA-20℃Reagent 41EA-20℃Required Materials and Equipment (Not Provided)Spectrophotometer / Microplate reader, benchtop centrifuge, adjustable pipettes, micro quartz cuvette / 96-well plate, mortar and pestle, ice, and distilled water.Sample Preparation:1.Bacteria or Cultured Cells:Collect cells by centrifugation and discard the supernatant.Add Extraction Buffer at a ratio of 1 ml per 5-10 million cells (e.g., 1 ml for 5 million cells).Sonicate on ice (20% power or 200W, pulse 3s on/10s off, repeat 30 times).Centrifuge at 8000 g, 4°C for 10 min. Collect the supernatant and keep it on ice for assay.2.Tissues:Homogenize tissue on ice in Extraction Buffer at a ratio of 1:5-10 (w/v) (e.g., 0.1 g tissue in 1 ml buffer).Centrifuge at 8000 g, 4°C for 10 min. Collect the supernatant and keep it on ice for assay.3.Serum (or Plasma) Samples:Assay directly.Assay Procedure:1.Preheat the spectrophotometer or microplate reader for at least 30 minutes. Set the wavelength to 340 nm. Zero the instrument with distilled water.2.Preparation of Working Solution: Just before use, transfer and dissolve Reagent 2 and Reagent 3 into Reagent 1. Mix well. Aliquot and store any unused portions at -20°C. Avoid repeated freeze-thaw cycles.3.Preparation of Reagent 4: Just before use, dissolve the contents of the vial in 1 ml of distilled water. Mix well. Aliquot and store any unused portions at -20°C. Avoid repeated freeze-thaw cycles.4.Pre-warm the Working Solution and dissolved Reagent 4 at 37°C (for mammalian samples) or 25°C (for other species) for 5 minutes.5.In a micro quartz cuvette or a well of a 96-well plate, add:10 µl sample10 µl dissolved Reagent 4180 µl pre-warmed Working SolutionMix immediately and record the initial absorbance (A₁) at 340 nm. Record the absorbance again (A₂) after exactly 1 minute. Calculate ΔA = A₁ - A₂.Note: For this kit, if ΔA is greater than 0.1, dilute the sample with Extraction Buffer by an appropriate factor (account for this dilution factor 'n' in the calculations) so that ΔA is less than 0.1 to improve detection sensitivity.PEPCK Activity Calculation:1. Calculation for Micro Quartz Cuvette (d = 1.0 cm)General Parameters for Cuvette:Vₜₒₜₐₗ (Total reaction volume) = 0.0002 L (200 µL)ε (NADH molar extinction coefficient) = 6220 L/mol/cmd (Cuvette light path) = 1.0 cmVₛₐₘₚₗₑ (Sample volume in reaction) = 0.01 mL (10 µL)T (Reaction time) = 1 minVₛₐₘₚₗₑₜₒₜₐₗ (Total extract volume) = 1 mL (for tissues/cells)Cpr (Sample protein concentration, mg/mL)W (Sample mass, g)500 (Cell/Bacteria count in millions for example calculation: 5 million)a. For Serum (Plasma):Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per ml of serum.Calculation:PEPCK Activity (nmol/min/ml) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ Vₛₐₘₚₗₑ ÷ TSimplified Formula: PEPCK (nmol/min/ml) = 3215 × ΔAb. For Tissues, Bacteria, or Cells:Based on Sample Protein Concentration:Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per mg of protein.Calculation:PEPCK Activity (nmol/min/mg prot) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (Vₛₐₘₚₗₑ × Cpr) ÷ TSimplified Formula: PEPCK (nmol/min/mg prot) = 3215 × ΔA ÷ CprBased on Sample Fresh Weight:Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per gram of fresh tissue.Calculation:PEPCK Activity (nmol/min/g fresh weight) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (W × Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ) ÷ TSimplified Formula: PEPCK (nmol/min/g fresh weight) = 3215 × ΔA ÷ WBased on Bacterial or Cell Density:Definition: One unit of activity is defined as the amount of enzyme that consumes 1 nmol of NADH per minute per 10⁴ cells.Calculation (example for 5 million cells in 1 ml extract):PEPCK Activity (nmol/min/10⁴ cell) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (500 × Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ) ÷ TSimplified Formula: PEPCK (nmol/min/10⁴ cell) = 6.43 × ΔA2. Calculation for 96-Well Plate (d = 0.5 cm)General Parameters for 96-Well Plate:(All parameters remain the same except for the light path 'd')d (96-well plate light path) = 0.5 cma. For Serum (Plasma):Simplified Formula: PEPCK (nmol/min/ml) = 6430 × ΔAb. For Tissues, Bacteria, or Cells:Based on Sample Protein Concentration:Simplified Formula: PEPCK (nmol/min/mg prot) = 6430 × ΔA ÷ CprBased on Sample Fresh Weight:Simplified Formula: PEPCK (nmol/min/g fresh weight) = 6430 × ΔA ÷ WBased on Bacterial or Cell Density:Simplified Formula: PEPCK (nmol/min/10⁴ cell) = 12.86 × ΔAPrecautionsBefore formal assay, it is essential to perform a pilot test with 2-3 samples expected to have significant differences in activity... Read More | Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20&#Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801DRNase-Free Water1.5 mL-20℃. Avoid freeze/ Thaw cycle. Product Introduction This product is a specialized kit for one-step Real-Time RT-qPCR using the probe method (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT-qPCR reaction, reverse transcription and quantitative PCR are carried out in the same reaction system, and there is no need to add reagents or open the cap of the tube during the reaction process, which avoids contamination and improves the experimental efficiency at the same time. With high detection sensitivity, strong fluorescence signal and high signal-to-noise ratio, this product is very suitable for the detection of RNA viruses and other trace RNA. The special buffer system contained in this product can maximize the effectiveness of reverse transcriptase and DNA polymerase at the same time and improve the efficiency of the reaction. A wider linear range can be obtained with this product, more accurate quantification of the target gene, good reproducibility and high confidence.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument. Instruments that do not require ROX calibration (G665836) Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96 and others. Instruments that require High ROX calibration (G665801) ABI Prism 7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, and others.matters needing attention1.Before using the reagents in this kit, please mix them gently by turning them up and down to avoid foaming as much as possible, and use them after brief centrifugation.2.This product uses RNA as the template for one-step RT-PCR experiment, RNase contamination should be avoided during operation, it is recommended to operate RNA in a special area, use special instruments and consumables, the operator with a mask and disposable gloves and often change the gloves, the experiment-related consumables should be processed with 0.1% DEPC (diethyl ether pyrocarbonate) aqueous solution for 12 hours at 37℃, and autoclaved for 30 minutes before use. The consumables should be treated with 0.1% DEPC (diethylpyrocarbonate) aqueous solution at 37℃ for 12 hours and autoclaved for 30 minutes.3.Repeated freezing and thawing of each reagent in this kit should be avoided as much as possible; repeated freezing and thawing may degrade the product performance.4.This kit must use specific primers, the choice of primers can be selected according to specific experiments, the good or bad primer design directly affects the results of RT-qPCR reaction, the design of primers need to consider the GC content, primer length, primer position, the secondary structure of the PCR product and other factors, it is recommended to use a professional primer design software for design.5.This kit is recommended to use specific probes, and it is recommended to use professional design software for designing.UsageThe following examples are conventional reaction systems and conditions, which should be improved and optimized according to the different templates, primer structures and target fragment sizes in actual operation. (Please prepare the reaction solution on ice.)1. Dissolve RNA template, primers, 2× GoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix and RNase-Free Water and set aside on ice.2. PCR reaction system:reagents25µl reaction systemfinal concentration2×GoldStar Probe One Step Buffer12.5µl1×Forward Primer, 10µM0.5µl0.2µM¹⁾Reverse Primer, 10µM0.5µl0.2µM¹⁾Probe, 10µM0.5µl0.2µM²⁾GoldStar Probe One Step EnzymeMix1.0µl RNA TemplateXµl10pg-100ng³⁾50 x Low ROX or High ROX (optional)⁴⁾0.5µl1×RNase-Free WaterUp to 25µlNote: 1) Usually, better results can be obtained with a primer concentration of 0.2 µM, and 0.1-1.0 µM can be used as a reference for setting the range.(2) The concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, please refer to the instrument manual or the specific requirements for the use of each fluorescent probe for the adjustment of the concentration in actual use.(3) Usually the amount of RNA template is 10pg-100ng as a reference. Since the templates of different species contain different copy numbers of target genes, the templates can be diluted in gradient to determine the optimal amount of template to use.(4) The excitation optical system varies from instrument to instrument, choose to add 50×Low ROX or 50×High ROX according to the instrument using fluorescence quantification.3. Mix well, centrifuge briefly, and collect the solution at the bottom of the tube.4.RT-PCR reaction conditions:Note: 1) The hot start enzyme used in this product must be activated under the condition of pre-denaturation 95℃, 5-10min. 2) It is recommended to use the two-step PCR reaction program, if you can not get good experimental results due to the use of primers with lower Tm value, etc., you can try to carry out the three-step PCR amplification, and the annealing temperature should be set in the range of 56℃-64℃ as a reference... Read More | Product content: M665559Component50 TStorageM665559ABuffer GTT15 mLRTM665559BBuffer GL15 mLRTM665559CBuffer GW1（concentrate）13 mLRTM665559DBuffer GW2（concentrate）15 mLRTM665559EBuffer GE15 mLRTM665559FProteinase K1.25 mLRTM665559GSpin CoLumns DM with CoLLection Tubes50 Product content: M665559Component50 TStorageM665559ABuffer GTT15 mLRTM665559BBuffer GL15 mLRTM665559CBuffer GW1（concentrate）13 mLRTM665559DBuffer GW2（concentrate）15 mLRTM665559EBuffer GE15 mLRTM665559FProteinase K1.25 mLRTM665559GSpin CoLumns DM with CoLLection Tubes50 EART Product Introduction:This reagent kit is suitable for extracting high-purity total DNA from fresh or frozen mouse or rat tails. The method provided by this reagent kit is simple and feasible, and the purification process does not require phenol or chloroform extraction. It can obtain DNA fragments up to 50 kb, and can also effectively recover fragments of 100 bp. This reagent kit uses a unique lysis solution to effectively lyse mouse tail samples. The optimized buffer system efficiently binds the DNA generated after the lysis of mouse tail to the silica matrix adsorption column, while other pollutants can flow through the membrane; Inhibitors of PCR and other enzymatic reactions can be effectively removed through a two-step washing process, followed by washing with low salt buffer or water to obtain high-purity DNA. The purified DNA can be directly used for downstream experiments such as enzyme digestion, PCR, ReaL Time PCR, library construction, Southern BLot, and molecular labeling.Self prepared reagent: anhydrous ethanol.Preparation and important precautions before the experiment:1. Samples should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2.Before the first use, anhydrous ethanol should be added to BufferGW1 and BufferGW2 according to the instructions on the reagent bottle label.3. Before use, please check if there is any crystallization or precipitation in the Buffer GL. If there is any crystallization or precipitation, please dissolve the Buffer GL again in a 56 ℃ water bath.Operation steps:1. Take a tail of a rat or two mice with a length of 0.4-0.6 cm, grind it into fine powder in liquid nitrogen or cut it into pieces and place it in a centrifuge tube (provided by oneself). Join 180 µ L Buffer GTT, shake and mix well. Note: Ensure that the starting quantity of the organization does not exceed the recommended range.2. Add 20 µ L Protein K, vortex oscillation, thoroughly mix.3. Place in a 56 ℃ water bath until the tissue solution is completely clear. Generally, digestion is required for 6-8 hours. During the incubation process, vortex oscillation is required to evenly disperse the sample. Note: 1) If there is still gel like substance after incubation and vortex oscillation, digest overnight or add 20 more if necessary µ L Protein K digestion will not affect subsequent operations. 2) To remove RNA, add 4 after completing the above steps µ L 100 mg/mL RNase A solution, shake well and let stand at room temperature for 5-10 minutes.4.12000 rpm (~13400 × g) for 1 minute to remove undigested tissues similar to mouse hair. Transfer the supernatant to a new centrifuge tube (provided by oneself).5. Add 200 µ L Buffer GL, vortex oscillation, thoroughly mixed. Join 200 µ L anhydrous ethanol, vortex and shake, thoroughly mix. Short centrifugation allows the solution on the tube wall to be collected to the bottom of the tube.Attention: 1) After adding Buffer GL and anhydrous ethanol, immediately vortex and shake to mix well.2) If multiple samples are operated together, Buffer GL and anhydrous ethanol can be mixed in equal proportions and added to the samples together.3) The addition of Buffer GL and anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments.6. Add all the solutions obtained in step 5 to the adsorption column (Spin CoLumins DM) that has been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.8. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 8.9.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column, which will affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Note: 1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Incubating at room temperature for 5 minutes before centrifugation can increase yield.3) Use an additional 50-200 µ Re washing with L Buffer GE or sterilized water can increase yield.4) If you want to increase the final concentration of DNA, you can add the DNA eluent obtained in step 10 back onto the adsorption membrane and repeat step 10; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ L Buffer GE or off... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This kit combines efficient guanidine isothiocyanate lysis technology with silicon matrix membrane purification technology to efficiently extract total RNA from animal cells and tissues. The starting sample usually has a maximum of 30 mg of tissue or 1 x 107 cells. This reagent kit can also recover This kit combines efficient guanidine isothiocyanate lysis technology with silicon matrix membrane purification technology to efficiently extract total RNA from animal cells and tissues. The starting sample usually has a maximum of 30 mg of tissue or 1 x 107 cells. This reagent kit can also recover partially purified RNA, RNA obtained from in vitro transcription and enzymatic reactions. This reagent kit can extract and purify high-quality RNA with a molecular weight greater than 200 bases, with almost no DNA residue. If RNA experiments are to be conducted that are highly sensitive to trace amounts of DNA, residual DNA can be digested and removed on a column using DNase I without RNase. The extracted RNA can be used for downstream experiments such as RT-PCR, Northern Blot, Dot Blot, etc. R666020Component50 TStorageR666020ABuffer RL35 mLRTR666020BBuffer RW140 mLRTR666020CBuffer RW2 (concentrate)11 mLRTR666020DRNase-Free Water10 mLRTR666020ESpin Columns RM with Collection Tubes50 setsRTR666020FRNase-Free Centrifuge Tubes (1.5 mL)50 EART Self prepared reagents: β- Mercaptoethanol, anhydrous ethanol (newly opened or dedicated for RNA extraction).Preparation and important precautions before the experimentTo prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The extracted samples should avoid repeated freeze-thaw cycles, otherwise it will affect the quantity and quality of RNA extraction.3. Before use, please check if there is any crystallization or precipitation in the Buffer RL. It can be heated at 56 ℃ and re solved. Please add Buffer RL before use β- Mercaptoethanol, with a final concentration of 1%. Add 10 to 1ml Buffer RL µ L β- Mercaptoethanol. join β- The buffer RL room temperature of mercaptoethanol can be stored for one month.4. Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.6. If downstream experiments are highly sensitive to DNA, it is recommended to treat RNA with DNase I that does not contain RNase.Operation steps1. Sample processing1a organization: Grind the organization in liquid nitrogen. Add 600 to every 20-30 mg of tissue µ L Buffer RL (check if it is added before use) β- Mercaptoethanol), tissue sample less than 20 mg plus 350 µ Buffer RL. The sample volume shall not exceed one tenth of the buffer RL volume.1b Single layer culture of cells: The cells are directly lysed or processed into cell suspensions in a culture bottle, centrifuged to obtain cell precipitates, and the supernatant is discarded. 600 is added every 6-10 cm2 of culture area µ Buffer RL, less than 6 cm2, add 350 µ Blow buffer RL several times to fully crack it.1c cell suspension: Centrifuge at 12000 rpm (~13400 × g) for 1 minute to discard the supernatant and obtain cell precipitate. Add 600 cells every 5 × 106-1 × 107 cells µ Buffer RL, less than 5 × 106 cells added to 350 µ Blow buffer RL several times to fully crack it.Attention:1) Try to eliminate the cell culture medium as much as possible, as it may inhibit cell lysis and affect RNA production.2) Try to fully suspend and lyse the cells, otherwise it will affect RNA production.2. After the sample is fully lysed, it should be left at room temperature for 5 minutes to completely separate the protein nucleic acid complex.3. Centrifuge at 2000rpm for 2-5 minutes, take the supernatant and proceed to the next step.4. Add 1 volume (600) µ L or 350 µ l) Mix 70% ethanol (prepared without RNase water) well.Attention: Adding ethanol may cause precipitation and will not affect subsequent experiments.5. Add all the solution obtained in step 4 to the Spin Columns RM that has been loaded into the collection tube. If it is not possible to add all the solution to the adsorption column at once, please transfer it in two batches, centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube. Attention: The maximum loading capacity of the adsorption column is 100 µ g, do not overload, otherwise it will affect the yield and purity of RNA.6. Add 700 to the adsorption column µ Centrifuge at 12000 rpm for 1 minute, discard the waste liquid from the collection tube, and place the adsorption column in the collection tube.Optional steps: If conducting RNA experiments that are highly sensitive to trace amounts of DNA, replace step 6 with the following steps.1) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.2) Preparation of DNase I mixture: Take 52 µ Add 8 RNase Free Water to it µ 10 x Reaction Buffer and 20 µ DNase I (1 U/ µ l) Mix well and prepare to a final volume of 80 µ The reaction solution of L.Attention: The above system is configured according to our company's DNase I reaction system. Please refer to the corresponding manual for other company products.3) Add 80 µ l of the prepared DNase I reaction solution directly to the adsorption column and incubate at 20-30 ℃ for 15 minutes.4) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.7. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube.8. Repeat step 7. 9. Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column in a new RNase free centrifuge tube, and add 30-50 to the middle of the adsorption column in the air µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 10 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 10... Read More |