| Description | ECL Universal Chemiluminescence Kit (Femto-grade) is a non-radioactive chemiluminescence system designed for detecting the activity of horseradish peroxidase (HRP) conjugated to proteins bound on PVDF or NC membranes. This product includes an enhanced luminol substrate and a stable peroxide solutionECL Universal Chemiluminescence Kit (Femto-grade) is a non-radioactive chemiluminescence system designed for detecting the activity of horseradish peroxidase (HRP) conjugated to proteins bound on PVDF or NC membranes. This product includes an enhanced luminol substrate and a stable peroxide solution, enabling the detection of trace amounts of protein as low as the femto-gram level. With a broad detection range and high sensitivity, it is suitable for most conventional Western Blot chemiluminescence detection applications.Component ListE1491293Component100 mL500 mLStorageE1491293AE-ECL Substrate50 mL250 mL2-8℃. Store in the dark.E1491293BE-ECL Oxidant50 mL250 mL2-8℃. Store in the dark. FeaturesHigh Sensitivity – Capable of rapidly detecting proteins at femto-gram levels, outperforming other high-end products in the same category.High Cost-Effectiveness – Offers exceptional value compared to other chemiluminescence substrates of similar grade.Instructions for UseRemove the transfer membrane from the washing buffer and drain excess liquid, ensuring the membrane remains moist.Mix E-ECL Substrate and E-ECL Oxidant in equal volumes to prepare the chemiluminescence working solution (approximately 0.1 mL per square centimeter of membrane).Evenly apply the chemiluminescence working solution onto the membrane and incubate for 1–2 minutes. For highly abundant target proteins, avoid letting the working solution remain stationary. Instead, place the membrane on a shaker for 1–2 minutes to prevent localized depletion of reactants, which may affect the linear range of detection signals.Remove the membrane and drain excess working solution. Wrap the membrane in a transparent protective cover.X-ray Film Exposure: In a darkroom, expose the membrane to X-ray film. Exposure times may range from a few seconds to several minutes. Develop the film and, if necessary, adjust the exposure time for a second exposure based on the initial results.CCD Imager: The membrane can be directly imaged without a protective cover. Follow the instrument’s instructions for imaging.The membrane can be stripped and reused for multiple hybridizations.PrecautionsAvoid strong light exposure to E-ECL Substrate and the working solution, as it may reduce sensitivity.Due to the high sensitivity of the ECL solution, avoid using excessively high antibody concentrations to prevent increased background signals.Sodium azide (NaN₃) inhibits HRP activity. Avoid using NaN₃ for the storage or recycling of secondary antibodies.For safety and health reasons, wear lab coats and disposable gloves during operation.This product is intended for research use only... Read More | Product DescriptionOur Glycan Sequencing Kit includes the enzymes and buffer required to sequence ten N-linked oligosaccharides.ContentsNeuraminidase from Arthrobacter ureafaciens – 80 µlBeta-Galactosidase from Streptococcus pneumoniae – 60 µlN-Acetylglucosaminidase from Product DescriptionOur Glycan Sequencing Kit includes the enzymes and buffer required to sequence ten N-linked oligosaccharides.ContentsNeuraminidase from Arthrobacter ureafaciens – 80 µlBeta-Galactosidase from Streptococcus pneumoniae – 60 µlN-Acetylglucosaminidase from Streptococcus pneumoniae) – 40 µlAlpha-Mannosidase from Jack Bean – 20 µlCore Alpha-Mannosidase from X. manihotis) – 10 µl5X Reaction buffer – 400 µlAnalysisMany methods of analysis are available, including HPLC, gel electrophoresis, HPAEC, capillary electrophoresis, and mass spectrometry. For more information on these methods, please contact us.StabilityThe Glycan Sequencing Kit is stable at least 12 months when stored properly. Several days exposure to ambient temperatures will not reduce activity.PurityAll Enzymes are tested for contaminating protease by incubating 10 µg of denatured BSA with 2 µl of enzyme at 37°C for 24 hours. SDS-PAGE analysis of the treated BSA shows no evidence of degradation.The production host strains for our recombinant enzymes have been extensively tested and do not produce any detectable glycosidases. Enzymes purified from native sources are tested for contaminating exoglycosidases The absence of exoglycosidase contaminants is confirmed by extended incubations with the corresponding pNP-glycosides... Read More | Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20&#Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801DRNase-Free Water1.5 mL-20℃. Avoid freeze/ Thaw cycle. Product Introduction This product is a specialized kit for one-step Real-Time RT-qPCR using the probe method (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT-qPCR reaction, reverse transcription and quantitative PCR are carried out in the same reaction system, and there is no need to add reagents or open the cap of the tube during the reaction process, which avoids contamination and improves the experimental efficiency at the same time. With high detection sensitivity, strong fluorescence signal and high signal-to-noise ratio, this product is very suitable for the detection of RNA viruses and other trace RNA. The special buffer system contained in this product can maximize the effectiveness of reverse transcriptase and DNA polymerase at the same time and improve the efficiency of the reaction. A wider linear range can be obtained with this product, more accurate quantification of the target gene, good reproducibility and high confidence.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument. Instruments that do not require ROX calibration (G665836) Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96 and others. Instruments that require High ROX calibration (G665801) ABI Prism 7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, and others.matters needing attention1.Before using the reagents in this kit, please mix them gently by turning them up and down to avoid foaming as much as possible, and use them after brief centrifugation.2.This product uses RNA as the template for one-step RT-PCR experiment, RNase contamination should be avoided during operation, it is recommended to operate RNA in a special area, use special instruments and consumables, the operator with a mask and disposable gloves and often change the gloves, the experiment-related consumables should be processed with 0.1% DEPC (diethyl ether pyrocarbonate) aqueous solution for 12 hours at 37℃, and autoclaved for 30 minutes before use. The consumables should be treated with 0.1% DEPC (diethylpyrocarbonate) aqueous solution at 37℃ for 12 hours and autoclaved for 30 minutes.3.Repeated freezing and thawing of each reagent in this kit should be avoided as much as possible; repeated freezing and thawing may degrade the product performance.4.This kit must use specific primers, the choice of primers can be selected according to specific experiments, the good or bad primer design directly affects the results of RT-qPCR reaction, the design of primers need to consider the GC content, primer length, primer position, the secondary structure of the PCR product and other factors, it is recommended to use a professional primer design software for design.5.This kit is recommended to use specific probes, and it is recommended to use professional design software for designing.UsageThe following examples are conventional reaction systems and conditions, which should be improved and optimized according to the different templates, primer structures and target fragment sizes in actual operation. (Please prepare the reaction solution on ice.)1. Dissolve RNA template, primers, 2× GoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix and RNase-Free Water and set aside on ice.2. PCR reaction system:reagents25µl reaction systemfinal concentration2×GoldStar Probe One Step Buffer12.5µl1×Forward Primer, 10µM0.5µl0.2µM¹⁾Reverse Primer, 10µM0.5µl0.2µM¹⁾Probe, 10µM0.5µl0.2µM²⁾GoldStar Probe One Step EnzymeMix1.0µl RNA TemplateXµl10pg-100ng³⁾50 x Low ROX or High ROX (optional)⁴⁾0.5µl1×RNase-Free WaterUp to 25µlNote: 1) Usually, better results can be obtained with a primer concentration of 0.2 µM, and 0.1-1.0 µM can be used as a reference for setting the range.(2) The concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, please refer to the instrument manual or the specific requirements for the use of each fluorescent probe for the adjustment of the concentration in actual use.(3) Usually the amount of RNA template is 10pg-100ng as a reference. Since the templates of different species contain different copy numbers of target genes, the templates can be diluted in gradient to determine the optimal amount of template to use.(4) The excitation optical system varies from instrument to instrument, choose to add 50×Low ROX or 50×High ROX according to the instrument using fluorescence quantification.3. Mix well, centrifuge briefly, and collect the solution at the bottom of the tube.4.RT-PCR reaction conditions:Note: 1) The hot start enzyme used in this product must be activated under the condition of pre-denaturation 95℃, 5-10min. 2) It is recommended to use the two-step PCR reaction program, if you can not get good experimental results due to the use of primers with lower Tm value, etc., you can try to carry out the three-step PCR amplification, and the annealing temperature should be set in the range of 56℃-64℃ as a reference... Read More | DescriptionUse in combination with the KitAlysis Bench Top Inertion Box (Z742064) or a glove box/glove bag to provide inert atmosphere for kit set-up.Designed to be used with KitAlysis High-Throughput Screening Kits.Components:24-Well Reaction BlockTorque ScrewdriverSmall screwdriver to easily DescriptionUse in combination with the KitAlysis Bench Top Inertion Box (Z742064) or a glove box/glove bag to provide inert atmosphere for kit set-up.Designed to be used with KitAlysis High-Throughput Screening Kits.Components:24-Well Reaction BlockTorque ScrewdriverSmall screwdriver to easily remove torqued screws after reaction is complete.10 Reaction Block Replacement Screws... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |