| Description | Firefly Luciferase Reporter Gene Assay Kit (Glow) is a glow-type quantitative detection kit characterized by high sensitivity and stable luminescent signals. It is suitable for high-throughput detection of firefly luciferase expression in mammalian cells. This product significantly enhances Firefly Luciferase Reporter Gene Assay Kit (Glow) is a glow-type quantitative detection kit characterized by high sensitivity and stable luminescent signals. It is suitable for high-throughput detection of firefly luciferase expression in mammalian cells. This product significantly enhances luminescent signal intensity, effectively improving detection sensitivity. It can be used to detect firefly luciferase reporter gene expression in ADCC Reporter Bioassays or cells. G1375755Component10 mL100 mLStorageG1375755AFirefly Luciferase Reaction Buffer (Glow)10 mL100 mL-20℃. Store in the dark.G1375755BFirefly Luciferase Substrate (Glow)1 vial1 vial-20℃. Store in the dark.he main features and differences among three One-Step Firefly Luciferase Reporter Gene Assay Kits from Aladdin are as follows:For high luminescent signal requirements and detection within 30 minutes: Recommended: Firefly Luciferase Reporter Gene Assay Kit (Glow Bright) (Cat. No. B1375760)For both luminescent signal and stability requirements, suitable for batch or continuous operation: Recommended: Firefly Luciferase Reporter Gene Assay Kit (Cat. No. F773892)For standard luminescent signal requirements: Recommended: Firefly Luciferase Reporter Gene Assay Kit (Glow) (Cat. No. G1375755)For routine laboratory detection, the Firefly Luciferase Reporter Gene Assay Kit (Glow Bright) (Cat. No. B1375760) is the recommended priority. Product Cat. No.Product NameLuminescence TypeSignal IntensitySensitivityHalf-LifePackagingSuitable for Batch SamplesOptimal Use After Mixing & Storing at -20°CF773892Firefly Luciferase Reporter Gene Assay KitGlowRelatively HighRelatively SensitiveUp to 2h1 bottle Buffer1 vial SubstrateVery Suitable1 MonthG1375755Firefly Luciferase Reporter Gene Assay Kit (Glow)GlowHighSensitive25-30min1 bottle Buffer1 vial SubstrateVery Suitable1 WeekB1375760Firefly Luciferase Reporter Gene Assay Kit (Glow Bright)GlowVery HighHighly Sensitive25-30min1 bottle Buffer1 vial SubstrateVery Suitable1 WeekInstructions for Use:1. User-Supplied MaterialsPBSMultichannel pipetteWhite or black opaque cell culture microplateLuminometer or microplate reader equipped with a luminescence detection module.2. Preparation Before Assay(1) Initial Reconstitution: Upon first use, transfer the entire contents of the Firefly Luciferase Reaction Buffer (Glow) bottle into the Firefly Luciferase Substrate (Glow) vial. Mix thoroughly until the substrate is completely dissolved. Aliquot the reconstituted detection reagent as needed. For long-term storage, aliquot and store at -70°C. For short-term storage, store aliquots at -20°C for no longer than one month. Use reconstituted reagent promptly.(2) Pre-assay: Before each experiment, equilibrate the aliquoted, frozen detection reagent to room temperature.3. Procedure(1) Equilibrate Plates: Remove the cell culture plate from the incubator and allow it to stand at room temperature for 5-15 minutes.Note: Use white or black opaque cell culture plates to minimize signal interference between wells.(2) Add Detection Reagent: Using a multichannel pipette, add the equilibrated Firefly Luciferase Reaction Buffer (Glow) containing the substrate to each cell culture well. The volume added should be equal to the volume of the culture medium in the well. For example:* 96-well plate: Typically add 80-100 µL culture medium; add 80-100 µL detection reagent.* 384-well plate: Typically add 20-30 µL culture medium; add 20-30 µL detection reagent.(3) Mix to Lyse Cells: To ensure complete cell lysis, place the plate on an orbital shaker or an instrument with shaking capability. Shake at medium to high speed at room temperature for 5 minutes.Note: A shaking time of 5 minutes is recommended. This can be adjusted based on cell density to ensure complete lysis and stable luminescent results.(4) Detection: Following the shaking step, immediately measure firefly luciferase reporter gene activity using a luminometer or microplate reader.Note: For optimal results, perform the detection as soon as possible after adding the detection reagent.PrecautionsInstrument Selection: Any instrument capable of detecting chemiluminescence is suitable for use with this kit. However, background signal levels and measured values for identical samples may vary between different detectors. Values obtained from different instruments for the same sample are not directly comparable. To prevent well-to-well interference, the use of opaque white or black cell culture plates is strongly recommended.Consistent Conditions: Luminescent signals can be influenced by environmental factors such as medium components and temperature. Ensure consistent detection conditions across all samples within an experiment.Temperature Sensitivity: The enzymatic reaction is temperature-sensitive. It is essential to equilibrate both the detection reagent and the cell culture plate to room temperature before adding the reagent and performing the assay.Reagent Stability: To maintain the stability of the luciferase assay reagent, aliquot it appropriately after reconstitution. For long-term storage, store aliquots at -70°C protected from light. For short-term storage, store at -20°C for no longer than one month. Use aliquots promptly and avoid repeated freeze-thaw cycles.Multiple Plate Assay: If detecting multiple cell culture plates simultaneously, strive to maintain consistent incubation time after adding the detection reagent to each plate before reading. This ensures optimal and comparable results across plates.Emission Wavelength: The bioluminescence catalyzed by firefly luciferase exhibits a peak emission wavelength of 560 nm... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Product introduction：This kit uses uniqcell lysis and heme / protein precipitation technology, combined with DNA preparation membrane to selectively adsorb DNA to achieve the purpose of purifying genomic DNA.Scope of application：Nucleic acid extraction and purification | Format:2-ComponentEnzyme:Horseradish peroxidase | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |