| Description | Inquire | Calcium, the most abundant mineral in the human body, is a crucial intracellular element that is responsible for regulating many physiological and pathological processes. Calcium is found in either the free ion form or in bound complexes, for example the calcium phosphate and calcium carbonate Calcium, the most abundant mineral in the human body, is a crucial intracellular element that is responsible for regulating many physiological and pathological processes. Calcium is found in either the free ion form or in bound complexes, for example the calcium phosphate and calcium carbonate complexes that make up bone tissue. Numerous physiological processes, including muscle contraction, cell adhesion, hormones/ neurotransmitters release, glycogen metabolism, cell proliferation/differentiation, blood clotting, nerve or synapthetic impulse transmission, and structural support of the skeleton are regulated by calcium signaling. Defects in the integrity of cell-specific calcium signaling systems may be associated with certain human diseases.Calcium Colorimetric Assay kit has been used to measure calcium concentration in hippocampal samples and MC3T3-E1 mouse osteoblast cell line, which were cultured in osteogenic induction medium... Read More | Product introduction:Dualucif The firefly & Renilla assay kit (dual luciferase reporter assay kit) provides an effective means to detect the expression of genes. In DLR detection, the activities of firefly luciferase and Renilla luciferase can be detected in a single sample in turn. FirstProduct introduction:Dualucif The firefly & Renilla assay kit (dual luciferase reporter assay kit) provides an effective means to detect the expression of genes. In DLR detection, the activities of firefly luciferase and Renilla luciferase can be detected in a single sample in turn. First, luciferin was used as substrate to detect the activity of firefly luciferase, then substances inhibiting the catalysis of firefly luciferase were added, and coelenterazine was added to detect the activity of Renilla luciferase to achieve dual luciferase reporter gene detection. The bioluminescence system of luciferase and its substrate can detect gene expression very sensitively and efficiently. Usually, the transcriptional regulatory element or 5'promoter region of the gene of interest is cloned upstream of luciferase, or the 3'-utr region is cloned downstream of luciferase to construct a reporter gene plasmid, and then transfect the cells. After the cells are treated with appropriate drugs, the cells are lysed, and the transcriptional regulation effect of drug treatment on the target gene is judged by detecting the luciferase activity. Renilla luciferase is more often used as an internal reference for detecting transfection efficiency to eliminate the difference in cell number and transfection efficiency. Firefly luciferase is a protein with a molecular weight of about 61 kDa. In the presence of ATP, magnesium ions and oxygen, it can catalyze the production of oxyluciferin from luciferin. In the process of luciferin oxidation, it will produce a light signal. Renilla luciferase is a protein with a molecular weight of about 36 kDa. In the presence of oxygen, it can catalyze the oxidation of coelenteramide to coelenteramide, and also produce light signals in the process of coelenteramide oxidation. The optical signal of this kit can be measured by chemiluminescence instrument, microplate reader or liquid scintillation tester. The kit has the characteristics of rapid detection, high sensitivity, wide detection range and no interference of cell endogenous activity.Instruction:1.Cell lysis ( 1 ) Remove the medium and gently wash twice with PBS ( adherent cells can be operated directly, suspension cells need to be centrifuged to collect cells ). Add 1 × Lysis Buffer ( diluted component A with sterile water at 4 : 1 ) according to the following scheme, and then place the culture plate on a micro-oscillator at room temperature for 15 min to fully lyse the cells. Note : The pyrolysis products can be stored at room temperature for 6 h, and can be stored at − 70 °C for a long time ( the pyrolysis products cannot be repeatedly frozen and thawed ). ( 2 ) The pyrolysis products were centrifuged at 10000-15000 rpm for 3-5 min. After centrifugation, the supernatant was transferred into a new EP tube for subsequent detection. Note : Cells can be detected immediately after lysis, or frozen, and re-detected when needed. The frozen samples need to be thawed to room temperature for detection. 2. Preparation of working fluid ( 1 ) Restore all components to room temperature. ( 2 ) Dilute component C with component B to 0.2 mg / mL firefly luciferase working solution. Note : The firefly luciferase working solution cannot be repeatedly frozen and thawed. If the amount of a single experiment is small, it is recommended to be subpackaged into small specifications according to a single amount of use. ( 3 ) The E component was diluted into the renilla luciferase working solution with the D component, and the dilution method was 1 µL E component was added to the 49 µL D component. Note : Renilla luciferase working solution needs to be prepared now. 3.chemiluminescence value detection ( 1 ) According to the operation instructions of the instrument, the instrument with chemiluminescence detection function was opened, such as multifunctional microplate reader. The parameters were set, the determination time was 10 s, and the determination interval was 2 s. ( 2 ) each sample determination, take the sample 20-100 µL ( if the sample volume is enough, please add 100 µL ; if the sample amount is insufficient, the amount can be appropriately reduced, but the amount of detection holes needs to be consistent ). 1 × Lysis Buffer was blank control. ( 3 ) 100 µL firefly luciferase working solution was added to determine the RLU ( relative light unit ) value ( it is recommended that the microplate reader set up the Shaking mixing function ). Note : Since the luminescence is instantaneous, it is recommended to detect immediately after adding the firefly luciferase working solution. ( 4 ) 100 µL renilla luciferase working solution was added to determine the RLU ( relative light unit ) value ( Shaking mixing function is recommended for microplate reader ). ( 5 ) In the case of renilla luciferase as an internal reference, the RLU value measured by firefly luciferase was divided by the RLU value measured by renilla luciferase. According to the obtained ratio, the activation degree of the target reporter gene between different samples was compared. If firefly luciferase is used as an internal reference, similar calculations can also be performed.Component:Recommendation:It is recommended to use component B in advance to prepare 2 mg / mL storage solution, component B, component D and component C prepared as storage solution, and to carry out small batch packing according to the experimental requirements. All test working fluids are recommended to be used now to avoid repeated freezing and thawing.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. in order to obtain the best determination effect, when using a single tube chemiluminescence instrument for determination, the time from the mixing of sample and determination reagent to the pre determination should be controlled as much as possible; When using a multi-functional fluorescent microplate reader with chemiluminescence detection function, it is advisable to add all samples first, and then uniformly add firefly luciferase detection reagent. 3. the strongest wavelength of firefly luciferase catalyzed bioluminescence is 560 nm, and the strongest wavelength of Renilla luciferase catalyzed bioluminescence is 480 nm. 4. to prevent interference between holes, it is recommended to use white opaque orifice plate. 5. due to the influence of temperature on enzyme reaction, the sample and reagent should be measured after reaching room temperature. 6. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application:Study on gene expression regulation and promoter... Read More | The miRNA extraction kit is specifically designed to isolate and purify miRNAs from various animal tissues, plant tissues, cells, serum, plasma and other samples. It can also extract small molecule RNAs such as siRNA and snRNA that are less than 200 nt, and can also be used for the extraction of The miRNA extraction kit is specifically designed to isolate and purify miRNAs from various animal tissues, plant tissues, cells, serum, plasma and other samples. It can also extract small molecule RNAs such as siRNA and snRNA that are less than 200 nt, and can also be used for the extraction of total RNA. This product combines phenol/guanidine lysis technology and silicon matrix membrane purification technology. The unique lysis solution can effectively inhibit RNases while removing most of DNA and proteins from cell or tissue samples through organic extraction. For some sensitive downstream experiments, if miRNA enrichment is required, this kit can be used to enrich miRNA separately. This product is suitable for a wide range of samples, with high purity of prepared RNA, and can be directly used for sensitive downstream applications, such as Northern Blot analysis, Real Time PCR, Microarray Analysis, etc. M665531Component50 TStorageM665531ATRIzon Reagent60 mL2-8℃. Protect from ligt.M665531BBuffer RWT (concentrate)15 mLRTM665531CBuffer RW2 (concentrate)11 mLRTM665531DRNase-Free Water10 mLRTM665531ESpin Columns RM with Collection Tubes50 setsRTM665531FSpin Columns RS with Collection Tubes50 setsRTM665531GRNase-Free Centrifuge Tubes (1.5 mL)50 EART Self prepared reagents: chloroform, anhydrous ethanol (newly opened or dedicated for RNA extraction).Preparation and important precautions before the experiment:To prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The extracted samples should avoid repeated freeze-thaw cycles, otherwise it will affect the quantity and quality of miRNA extraction.Before the first use, anhydrous ethanol should be added to Buffer RWT and Buffer RW2 according to the instructions on the reagent bottle label.4. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.Operation steps:Protocol A: miRNA enrichment (can be directly used for sensitive downstream experiments)1. Sample processing1a Organization: Grind the organization in liquid nitrogen. Add 1 ml of TRIzon Reagent to every 30-50 mg of tissue, shake and mix well. The sample volume shall not exceed one tenth of the volume of TRIzon Reagent.1b Single layer culture of cells: Remove the culture medium, add TRIzon Reagent, and add 1 ml of TRIzon Reagent every 10 cm2 (the amount of lysis solution depends on the area of the culture bottle).1c Cell suspension: Centrifuge to obtain cell precipitate, discard supernatant. Add 1 ml of TRIzon Reagent to every 5 x 106-1 x 107 cells (cells do not require washing).1d Plasma or serum: Take 200 µ Add 5 times the volume of TRIzon Reagent to plasma or serum samples, shake and mix well for 30 seconds.2. After adding TRIzon Reagent to the sample, blow it repeatedly several times to fully crack it. Leave at room temperature for 5 minutes to completely separate the protein nucleic acid complex.3. Optional steps: Centrifuge at 4 ℃ 12000 rpm (~13400 × g) for 5 minutes, take the supernatant, and transfer it to a new centrifuge tube (provided by oneself) (if the sample contains more proteins, fats, polysaccharides, etc., this step can be performed).4. Add chloroform to the supernatant and add 200 to every 1 ml of TRIzon Reagent used µ Chloroform, cover the tube, vigorously shake for 15 seconds, and let it sit at room temperature for 5 minutes.Centrifuge at 5.4 ℃ and 12000 rpm for 15 minutes. The sample is divided into three layers: red organic phase, middle layer, and colorless aqueous phase. Transfer the upper colorless aqueous phase to a new centrifuge tube (self prepared).6. Add 1/3 volume of anhydrous ethanol to the solution obtained in step 5, mix well, and transfer the obtained solution and precipitate together into the adsorption column RM (Spin Columns RM) that has been loaded into the collection tube. If you cannot add all the solution to the adsorption column at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the adsorption column RM after centrifugation, and retain the effluent.7. Add 2/3 times the volume of anhydrous ethanol to the solution obtained in step 6 and mix well.8. Transfer the solution and precipitate obtained from the previous step into the adsorption column RS (Spin Columns RS) that has been loaded into the collection tube. If you cannot add all the solution to the adsorption column at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.9. Add 700 to the adsorption column RS µ L Buffer RWT (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.10. Add 500 to the adsorption column RS µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.11. Repeat step 10.12. Centrifuge at 12000 rpm for 1 minute and discard the waste liquid from the collection tube. Place the adsorption column RS at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column RS, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).13. Place the adsorption column RS in a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store the obtained RNA solution at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 13 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column RS and repeat step 13Protocol B: Extraction of total RNA (including miRNA and other small molecule RNAs<200 nt), steps 1-5 are the same as protocol A.6. Add 1.25 times the volume of anhydrous ethanol to the solution obtained in step 5 and mix well.7. Transfer the solution and precipitate obtained from the previous step into the spin columns RM that have been loaded into the collection tube. If you cannot add all the solution to the adsorption column RM at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.8. Add 700 to the adsorption column RM µ L Buffer RWT (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.9. Add 500 to the adsorption column RM µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.10. Repeat step 9.11. Centrifuge at 12000 rpm for 1 minute and discard the waste liquid from the collection tube. Place the adsorption column RM at room temperature for a few minutes to thoroughly air dry. Attention: The purpose of this step is to remove residual ethanol from the adsorption column RM, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).12. Transfer the adsorption column RM into a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store the obtained RNA solution at -70 ℃ to prevent degradation. Attention: 1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 12 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column RM and repeat step 12... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |