| Description | Inquire | Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize matrix effects, cross-reactions and unspecific binding in immunoassays like ELISA, Western blotting, Immunohistochemistry, protein arrays and immuno-PCR.The Effect Diluents, Animal-free are used alternatively to the standard sample or antibody dilution buffers: In ELISA for the dilution of specimen and detection antibodies. In Western Blotting for the dilution of primary and secondary antibodies. In Protein arrays for the dilution of specimen and detection antibodies. In immuno-PCR as a washing buffer.Three versions of the diluent are offered: Low, Medium and High for optimal discrimination between specific and unspecific reaction and for minimizing strong interference effects e.g., by RF (rheumatoid factors), HAMAs (human-a-mouse Abs) or by endogenous components that bind and mask the analyte.Composition & Properties The Effect Diluents, Animal free contain no animal components and are free of phosphates.Working Procedure 1.Mix thoroughly prior to use. 2.Dilution recommendations a.Dilute antibodies according to the instruction of the antibody b.Dilution of the specimen is recommended at 1:2 or higherTips & TricksEffect Diluents must not be considered as blocking buffers. Recommended blocking buffers are: Synthetic Blocking Buffer, ELISA (cat. no. S494401), Synthetic Blocking Buffer, Blotting (cat. no. S494457) and WellChampion (cat. no. W494467) for plate blocking and stabilization (preparation of pre-coated plates). Complex sample matrices, such as serum and plasma, may contain interfering factors that affect the ability of the assay to accurately quantify the target analyte. Strong interferences are often caused by RFs and HAMAs. This matrix effect can cause high background in the negative control or false negatives in the sample measurement. To reduce this effect the samples can be diluted in the Effect Diluents, Animalfree.Handling & Storage Store solution 2-8°C or -15 to -30°C (tolerates freezing and thawing cycles)... Read More | H665581 Component 100 T Storage H665581A gDNA Eraser 50 µL -20℃. Avoid freeze/thaw cycle. H665581B 10×gDNA Eraser Buffer 120 µL -20℃. Avoid freeze/thaw cycle. H665581C HiFiScript, 200 U/µL 100 µL -20℃. Avoid freeze/thaw cycle. H665581D 5×ScriptRT H665581 Component 100 T Storage H665581A gDNA Eraser 50 µL -20℃. Avoid freeze/thaw cycle. H665581B 10×gDNA Eraser Buffer 120 µL -20℃. Avoid freeze/thaw cycle. H665581C HiFiScript, 200 U/µL 100 µL -20℃. Avoid freeze/thaw cycle. H665581D 5×ScriptRT Buffer 500 µL -20℃. Avoid freeze/thaw cycle. H665581E Primer Mix 120 µL -20℃. Avoid freeze/thaw cycle. H665581F RNase-Free Water 2×1 mL -20℃. Avoid freeze/thaw cycle.Product IntroductionThis product is a kit for removing genomic DNA for reverse transcription. The kit removes genomic DNA in 2 minutes at 42°C. Since the reverse transcription reagent contains a component that inhibits gDNA Eraser, cDNA can be synthesized directly by reverse transcription of gDNA Eraser-treated samples.The kit is equipped with a new high-efficiency reverse transcription enzyme, HiFiScript, with novel mutation sites that dramatically increase the transcriptional activity of the enzyme, resulting in higher efficiency and yield of cDNA first-strand synthesis. The first strand of cDNA can be synthesized with higher efficiency and yield, and the first strand of cDNA can be synthesized from pg total RNA or mRNA. If the reverse transcription product cDNA is used for downstream fluorescence quantitative detection, the reverse transcription reaction can be completed at 42℃ in 15 minutes. This kit is suitable for the synthesis of first-strand cDNA and subsequent RT-PCR, RT-qPCR, and the construction of full-length cDNA libraries.Product Features1. Rapid genome removal: contains gDNA Eraser for genomic DNA removal, which removes genomic DNA in just 2 minutes.2. Rapid reverse transcription: 15 minutes to obtain fluorescent quantitative PCR template cDNA first strand synthesis.3. High sensitivity: cDNA first strand can be synthesized using pg-level total RNA or mRNA templates.4. Highly efficient reverse transcription: Novel mutation sites dramatically increase enzyme activity, resulting in higher yields of cDNA.matters needing attention1. During operation, RNase contamination should be avoided to prevent RNA degradation or cross-contamination in the experiment. It is recommended that operators wear masks and disposable gloves and change the gloves frequently, and use specialized instruments and consumables.2. The reverse transcription system is prepared and operated on ice to prevent degradation of RNA. Store the kit enzymes at -20ºC as soon as possible after use and try to avoid repeated freezing and thawing.3. The reaction system can be scaled up to a maximum of 1 µg of total RNA in 10 µl of reaction system.4. Primer Mix is prepared by Oligo(dT) and Random primer, and Oligo-dT Primer or Gene Specific Primer can also be used according to the experimental needs.5. If the amount of starting RNA is less than 50ng, it is recommended to add RNAase inhibitor (RNasin).6. For RNA templates with complex secondary structures, it is recommended to incubate the template RNA at 65°C for 5 minutes immediately on ice prior to the manipulation step and centrifuge briefly before proceeding to the next step.UsageThaw template RNA on ice; place kit components on ice immediately after thawing at room temperature. Each solution was mixed by vortexing and shaking before use and briefly centrifuged.I. Genomic DNA removal reactions1. Prepare the reaction system according to the following table on ice in a total volume of 10 µl. To ensure the accuracy of the reaction solution preparation, prepare the premixed system in the amount of reaction number + 2 before dispensing it into each reaction tube and finally adding the RNA sample.Note: 1) If the amount of total RNA is greater than 1µg, scale up the reaction system proportionally. If the amount of starting RNA is less than 50ng, it is recommended to add RNAase inhibitor (RNasin).2. Mix by vortex shaking and centrifuge briefly so that the solution on the walls of the tube collects at the bottom.3. Incubate at 42°C for 2 minutes (this can be extended to 30 minutes for room temperature reactions).4．At the end of the reaction, centrifuge briefly and place on ice to cool.II. Reverse transcription reaction1. Prepare the reaction system on ice according to the following table. In order to ensure the accuracy of the reaction solution configuration, first prepare a premixed solution in the amount of number + 2, and then dispense 10 µl into each reaction tube, take 10 µl of the prepared premixed solution and add it to the reaction tube of step 1 where the de-etching of the genome has been completed.Note: 1) Oligo-dT Primer or Gene Specific Primer can be used according to the needs of the experiment, it is recommended to use 50 pmol of Oligo-dT Primer or 2 pmol of Gene Specific Primer for 20 µl reaction system.2. Mix well and centrifuge briefly so that the solution on the walls of the tube collects at the bottom.3. cDNA synthesis reaction conditions:1) If fluorescent quantitative PCR assay is performed downstream, incubate at 42°C for 15 minutes and 85°C for 5 minutes.2) If downstream for normal PCR assay, incubate at 42°C for 30-50 minutes and 85°C for 5 minutes. Note: For templates with complex secondary structure or high GC content, the reverse transcription temperature can be increased to 50°C to enhance reverse transcription efficiency.4. At the end of the reaction, centrifuge briefly and place on ice before proceeding with subsequent PCR or fluorescence quantitative PCR, or place at -20°C if prolonged storage is required.Note: When performing Real-time PCR reactions, the amount of reverse transcription product added should not exceed 1/10 of the total volume of the PCR reaction... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This product is a cDNA first strand synthesis kit specially prepared for the first step experiment of two-step RT-PCR. The reverse transcriptase used in this kit is a novel and efficient reverse transcriptase that utilizes E. coli engineered bacteria for recombination and expression. It removes This product is a cDNA first strand synthesis kit specially prepared for the first step experiment of two-step RT-PCR. The reverse transcriptase used in this kit is a novel and efficient reverse transcriptase that utilizes E. coli engineered bacteria for recombination and expression. It removes RNase H activity and enhances its thermal stability. It can synthesize cDNA first strands using extremely low amounts of total RNA or mRNA, with an initial sample size as low as pg level. SuperRT reverse transcriptase has strong affinity for RNA and can read RNA templates with high GC content and complex secondary structures, obtaining high yields of cDNA. This product contains all the reagents required for reverse transcription from RNA templates to cDNA first strand, including Super RT efficient reverse transcriptase, reaction buffer, primers, dNTP, etc. It is simple and convenient to use. This system has high compatibility with subsequent PCR and quantitative PCR experiments, and is suitable for various DNA polymerase reactions. S665657 Component 100 T Storage S665657A SuperRT, 200 U/µL 100 µL -20℃. Avoid freeze/thaw cycle. S665657B 5×SuperRT Buffer 500 µL -20℃. Avoid freeze/thaw cycle. S665657C Primer Mix 240 µL -20℃. Avoid freeze/thaw cycle. S665657D dNTP Mix, 2.5 mM Each 500 µL -20℃. Avoid freeze/thaw cycle. S665657E RNase-Free Water 1 mL -20℃. Avoid freeze/thaw cycle.Product features:·Efficient reverse transcription: It has a high affinity for RNA templates, with a reverse transcription efficiency of up to 90%, and can recognize pg level templates.·Free response to complex templates: Even templates with high GC content and complex secondary structures can achieve good results without high-temperature denaturation.Notes:1. During the operation process, RNase contamination should be avoided to prevent RNA degradation or cross contamination during experiments. It is recommended to perform RNA operations in specialized areas, use specialized instruments and consumables, and have operators wear masks and disposable gloves, and frequently change gloves.2. Disposable plastic containers should be used as much as possible for experiments. If glass containers are used, they should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours, and sterilized under high pressure at 120 ℃ for 30 minutes before use. Alternatively, glass containers should be sterilized under dry heat at 180 ℃ for 60 minutes before use. The sterile water used in the experiment should be treated with 0.1% DEPC and then subjected to high-pressure sterilization.3. All reagents in this reagent kit should be gently mixed upside down before use, avoiding foaming as much as possible, and used after brief centrifugation. The enzymes involved should be returned to -20 ℃ as soon as possible after use to avoid repeated freeze-thaw cycles.If the initial amount of RNA is less than 50 ng, it is recommended to add RNA enzyme inhibitors (RNAsin). This kit is not provided.Usage:Note: 1 ng -5 µ g of total RNA can establish a 20 µ l reaction system. If the total RNA amount is greater than 5 µ g, please expand the reaction system proportionally.Steps for reverse transcription:1. Dissolve the RNA template, Primer Mix, dNTP Mix, SuperRT Buffer, SuperRT, and RNase Free Water and place them on ice for later use.2. Prepare a reaction system according to the following table, with a total volume of 20 µ L. Reagent 20 µlReaction system Final concentration dNTP Mix，2.5 mM Each 4 µl 500 µM Each Primer Mix 2 µl / RNA Template X µl 50 pg-5 µg SuperRT，200 U/µl 1 µl / RNase-Free Water up to 20 µl / Attention:1) If the initial amount of RNA is less than 50 ng, it is recommended to add RNA enzyme inhibitors (RNAsin). This kit is not provided.2) Primer Mix is formulated from Oligo (dT) and Random Primer. Oligo dT Primer or Gene Specific Primer can be used according to experimental needs, with a recommendation of 20 µ The reaction system Oligo dT Primer is 50 pmol, or Gene Specific Primer is 2 pmol.3. Vortex shake and mix well, briefly centrifuge to collect the solution on the pipe wall to the bottom of the pipe.Incubate at 4.42 ℃ for 30-50 minutes and 85 ℃ for 5 minutes. After the reaction is complete, centrifuge briefly and cool on ice.5. Reverse transcripts can be directly used for PCR reactions and fluorescence quantitative PCR reactions, or stored at -20 ℃ for a long time. Reagent 20 µ Final concentration of reaction system dNTP Mix, 2.5 mM Each 4 µ L 500 µ M Each Primer Mix 2 µ RNA Template X µ L 50 pg-5 µ g 5 x SuperRT Buffer 4 µ 1 x SuperRT, 200 U/ µ L 1 µ RNase Free Water up to 20 µ Lii If the reverse transcription efficiency is low, or the RNA template secondary structure is complex and the GC content is high, the following steps are recommended:1. Dissolve the RNA template, Primer Mix, dNTP Mix, SuperRT Buffer, SuperRT, and RNase Free Water and place them on ice for later use.2. Configure the reaction system according to the following table, with a total volume of 15 µ L. Reagent 20 µlReaction system Final concentration dNTP Mix，2.5 mM Each 4 µl 500 µM Each Primer Mix 2 µl / RNA Template X µl 50 pg-5 µg RNase-Free Water up to 15 µl / Note: Primer Mix is formulated from Oligo (dT) and Random Primer. Oligo dT Primer or Gene Specific Primer can be used according to experimental needs. 3. Incubate at 70 ℃ for 10 minutes and quickly ice bath for 2 minutes.4. Centrifuge briefly to collect the solution on the tube wall to the bottom of the tube.5. Continue to add the following reagents to the above reaction solution: Reagent 20 µlReaction system Final concentration 5×SuperRT Buffer 4 µl 1× SuperRT，200 U/µl 1 µl / Note: If the initial amount of RNA is less than 50 ng, it is recommended to add RNA enzyme inhibitors (RNasins). This kit is not provided. 6. Incubate at 42 ℃ for 30-50 minutes and 85 ℃ for 5 minutes.7. After the reaction is complete, centrifuge briefly and cool on ice.8. Reverse transcripts can be directly used for PCR reactions and fluorescence quantitative PCR reactions, or stored at -20 ℃ for a long time... Read More |