| Description | Reactive oxygen species (ROS) are natural by-products of normal oxygen metabolism, including superoxide radicals, hydrogen peroxide, and their downstream products such as peroxides and hydroxides. Studies show that over 95% of ROS in organisms originate from mitochondria. An imbalance leading Reactive oxygen species (ROS) are natural by-products of normal oxygen metabolism, including superoxide radicals, hydrogen peroxide, and their downstream products such as peroxides and hydroxides. Studies show that over 95% of ROS in organisms originate from mitochondria. An imbalance leading to oxidative stress is associated with cell growth, proliferation, development, differentiation, aging, apoptosis, and many physiological and pathological processes. Under normal conditions, a balance exists between the intracellular antioxidant defense system and oxygen free radicals, maintaining ROS at low physiological levels. Under pathological conditions, this balance is disrupted, leading to excessive intracellular ROS levels. This can damage mitochondrial enzymes, lipids, and nucleic acids, causing oxidative stress. Additionally, ROS can attack mitochondrial DNA, causing oxidative damage that leads to structural and functional changes such as reduced mitochondrial ATP synthesis and disrupted mitochondrial membrane potential. Mitochondrial Reactive Oxygen Species (ROS) Production Rate Assay Kit (Fluorometric Method) provides a simple, sensitive, and rapid method for detecting mitochondrial ROS production rate. The principle utilizes the fluorescent probe DCFH-DA for ROS detection. DCFH-DA (2',7'-Dichlorodihydrofluorescein diacetate) diffuses across the mitochondrial membrane and is hydrolyzed by esterases inside the mitochondria to form non-fluorescent DCFH. DCFH is then oxidized by ROS to generate fluorescent DCF. The rate of increase in DCF fluorescence intensity is proportional to the rate of ROS production.M1492773Component96TStorageM1492773AExtraction Buffer60 mL×22-8℃M1492773BReagentⅠ50 mL2-8℃M1492773CReagent Ⅱ1.5 mL-20℃. Store in the dark.M1492773DReagent Ⅲ1EA2-8℃. Store in the dark.M1492773EReagent Ⅳ1EA2-8℃. Store in the dark.M1492773FReagent Ⅴ1EA2-8℃. Store in the dark.M1492773GReagent Ⅵ20 µL-20℃. Store in the dark.Note: It is recommended to perform preliminary experiments using 2-3 samples expected to have significant differences before formal testing.User-Provided Instruments and ConsumablesAdjustable pipettes and tipsHomogenizer, Low-temperature centrifuge, 96-well solid black or solid white microplateConstant temperature incubator, Multifunctional microplate readerExperimental Procedure1. Reagent PreparationReagent NameReagent PreparationPrecautionsExtraction BufferReady-to-use; equilibrate to room temperature before use.Store at 4°CReagentⅠReady-to-use; equilibrate to room temperature before use.Store at 4°CReagentⅡReady-to-useStore at -20°C protected from light.ReagentⅢPrepare before use: Dissolve contents for 96 tests in 6 mL Reagent I. Mix well.Unused dissolved Reagent III can be stored at 4°C protected from light for 1 month.ReagentⅣPrepare before use: Dissolve contents for 96 tests in 6 mL Reagent I. Mix well.Unused dissolved Reagent IV can be stored at 4°C protected from light for 1 month.ReagentⅤPrepare before use: Dissolve contents for 96 tests in 6 mL Reagent I. Mix well.Unused dissolved Reagent V can be stored at 4°C protected from light for 1 month.ReagentⅥReagent VI is somewhat irritating; personal protection is recommended during use.Working ReagentⅥPrepare before use: Dilute Reagent VI 300-fold with Reagent I according to the required volume.Diluted Working Reagent VI cannot be reused.2. Sample Preparation (Tissue/Cell Mitochondria Extraction)2.1 Weigh approximately 0.1 g of tissue or collect 5 million cells. Add 1 mL of Extraction Buffer and 10 µL of Reagent II. Homogenize on ice using a homogenizer. Centrifuge at 600 g, 4°C for 5 minutes. Collect the supernatant into a new centrifuge tube, discard the pellet.2.2 Centrifuge the supernatant again at 11,000 g, 4°C for 10 minutes. The pellet contains the extracted mitochondria.2.3 Discard the supernatant. Resuspend the pellet in 200 µL of Reagent I. Keep on ice for immediate assay.Notes:(1) Fresh samples are recommended. If not used immediately, samples can be stored at -80°C for one month.(2) Extracted mitochondrial samples must be assayed on the same day and should not be frozen.(3) For protein concentration determination, Aladdin B774074 Bradford Protein Assay Kit or B406195 Bradford Assay Solution (Ready-to-Use) [for Protein Determination] is recommended.3. Assay Steps3.1 Pre-heat the multifunctional microplate reader to 37°C. Set the fluorescence excitation wavelength to 488 nm and emission wavelength to 525 nm.3.2 Add reagents to a 96-well solid black or solid white microplate as follows:ReagentBlank Well (µL)Test Well (µL)Sample020ReagentⅠ200ReagentⅢ5050ReagentⅣ5050ReagentⅤ5050Working ReagentⅥ30303.3 Mix well. Incubate at 37°C protected from light for 15 minutes.3.4 After incubation, measure the fluorescence intensity over 10 minutes using the microplate reader (Ex/Em = 488/525 nm). Maintain the instrument temperature at 37°C. Record the fluorescence change over 10 minutes.Notes:(1) Fluorescence intensity changes must be measured at a constant 37°C over 10 minutes.(2) When mixing with a pipette, pipette gently to avoid generating bubbles.(3) Use solid black or white 96-well plates to prevent interference between adjacent wells. 4. Result Calculation 4.1 Data Processing Perform linear regression analysis on the sampled data points (fluorescence intensity vs. time) to calculate the regression coefficient, i.e., the slope (k) of the line. The actual mitochondrial ROS production rate equals the slope (k test ) from the linear regression of the sample's fluorescence intensity vs. time data points minus the slope (k blank ) from the linear regression of the background fluorescence intensity vs. time data points. k = (RFU 10min - RFU 0min ) / 600 (assuming time in seconds; 10 min = 600 s) 4.2 Activity Calculation Note: We provide both derived and simplified calculation formulas, which are equivalent. The simplified formulas in bold are recommended as the final calculation formulas. (1) Based on sample mass: (1) Based on sample mass: ROS Production Rate (RFU/s/g fresh weight) = (k test - k blank ) ÷ (V sample ÷ V total × W) = 100 × (k test - k blank ) (2) Based on sample protein concentration: ROS Production Rate (RFU/s/mg prot) = (k test - k blank ) ÷ (V sample ÷ V total × Cpr) = 10 × (k test - k blank ) ÷ Cpr (3) Based on cell count: ROS Production Rate (RFU/s/10⁴ Cells) = (k tes t - k blank ) ÷ (500 × V sample ÷ V total ) = (k test - k blank ) ÷ 50 Parameter Description: V sample : Sample volume added, 0.02 mL V total : Total resuspension volume of the sample, 0.2 mLCpr: Sample protein concentration, mg/mLW: Sample mass, 0.1 g500: Cell count, in units of 10⁴Precautions1.Biochemical reagents are generally irritating and biologically toxic. For your safety and health, please implement appropriate biosafety precautions throughout the experiment. Wear personal protective equipment such as lab coats, masks, gloves, and hair caps. Perform experiments in a fume hood or biosafety cabinet.2.This product is for scientific research use only. Not intended for clinical diagnosis... Read More | When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in genomic DNA, a large number of sticky 3'-oh ends will be generated, which can interact with YF under the catalysis of deoxyribonucleotide terminal transferase (TDT) ®/ CY dUTP binding can directly detect apoptotic cells by fluorescence microscopy or flow cytometry. This kind of method is called terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL). Because normal or proliferating cells have almost no DNA breaks, there is no 3'-oh formation and they can rarely be stained. TUNEL method can stain intact single apoptotic nuclei or apoptotic bodies in situ, can accurately reflect the typical biochemical and morphological characteristics of apoptosis, and can detect a very small number of apoptotic cells, so it is widely used in the study of apoptosis. This kit has a wide range of applications and can be used to detect apoptosis in frozen or paraffin sections, as well as cultured adherent cells or suspended cells. It can selectively detect apoptotic cells, but not necrotic cells or cells with DNA strand breaks caused by irradiation and drug treatment. This kit detects cell apoptosis with a short time-consuming, one-step staining reaction and can be detected after washing. Component： Instruction： Experimental materials (self provided)PBS buffer (1 x, pH~7.4). 0.2% Triton X -100 (PBS formulation). 0.1% Triton X -100 (PBS formulation, containing 5 mg/mLBSA)4% paraformaldehyde (prepared with PBS)Immunohistochemical penDewaxing solvent (paraffin section sample)Related reagents for paraffin section processingAnti fluorescence quenching and sealing agent. ddH2Oexperimental design. A. Positive control:Prepare positive control slides using DNaseI treatment. DNaseI can digest single or double stranded DNA and expose the 3 '- OH end, artificially causing cell apoptosis. One experiment per time is sufficient. (To verify if there are any issues with the experimental operation and reagent kit)B. Negative control:Use TUNEL Reaction Buffer without TdT Enzyme and replace TdT Enzyme with ddH2O. (Mainly to exclude non-specific staining caused by cell apoptosis, operational processes, and other reasons; and to adjust the exposure intensity of the shooting.)C. Experimental processing group.The experimental group operated normally according to the instructions.D. Experimental control group.The experimental group operated normally according to the instructions.Experimental steps1. Sample preparation:(1) For adherent cells or cell smearsa. Clean once with PBS.Note: If you are concerned that the cells on the cell smear may not adhere firmly, you can dry the sample to make the cells adhere more firmly.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at 4 ℃ for 30 minutes. Clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Clean twice with PBS.d. Step 2: TUNEL reaction.(2) For suspended cells or cell suspensionsa. Collect cells (3-5 x 106 cells), centrifuge at 1000 rpm for 5 minutes, and wash twice with PBS.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and resuspend the cells thoroughly. Fix at 4 ℃ for 30 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.d. Step 2: TUNEL reaction.(3) Paraffin tissue sectioninga. Dewaxing and hydration: Place the sliced samples sequentially in xylene I (10 min) → xylene II (10 min) → 100% ethanol I (5 min) → 100% ethanol II (5 min) → 95% ethanol (5 min) → 90% ethanol (5 min) → 80% ethanol (5 min) → 70% ethanol (5 min) → ddH2O rinse for 5 min, rinse twice.Note: Xylene is toxic and volatile. Please perform this operation in a fume hood.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(4) Frozen tissue sectionsa. Fixation: Take out frozen sections and warm them back to room temperature. Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at room temperature for 30 minutes. Wash twice with PBS for 10 minutes each time.Note: If you are concerned that formaldehyde cleaning may not be clean enough, it may affect the final dyeing effect. After formaldehyde fixation is completed, an appropriate amount of 2 mg/mL glycine can be added and washed for 10 minutes to neutralize the residual fixing solution, and then PBS cleaning can be carried out.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(5) Positive treatment (only the positive control is subjected to this step, and other samples are directly subjected to the TUNEL reaction step)a. Dilute 10 x DNase I Buffer with ddH2O in a ratio of 1:10 to 1 x DNase I Buffer for later use.b. Drip 100 µ L of 1xDNase I Buffer onto the processed sample, covering all sample areas, and equilibrate at room temperature for 5 minutes.c. Dilute DNase I (2 U) with 1 x DNase I Buffer at a ratio of 1:100/ µ L) A working solution with a final concentration of 20 U/mL.d. Discard the buffer and add 100 µ Incubate DNase I working solution with a concentration of 20 U/mL at room temperature for 10 minutes.e. Discard DNase I working solution and clean twice with PBS.f. Step 2: TUNEL reaction.2. TUNEL reaction(1) Prepare TUNEL reaction solution (ready to use): / 1 sample 5 sample 10 sample TdT enzyme 1 µL 5 µL 10 µL YF®488/555/594/640 TUNEL Reaction Buffer 49 µL 245 µL 490 µL TUNEL Total volume of reaction solution 50 µL 250 µL 500 µL (2) For adherent cells, cell smears, or tissue sectionsa. Add 50 to each sample µ L TUNEL reaction solution, evenly cover the sample with the reaction solution. The appropriate time for dark incubation at 37 ℃ (recommended staining time for cells is 30 minutes to 1 hour, and tissue staining time is 2 hours).Note: 50 µ L TUNEL reaction solution is suitable for smear, slicing, or 96 well plates (other different well plates can adjust the volume of TUNEL reaction solution appropriately to cover cells). If the sample to be tested is a smear, slice, or in a 24 well plate, 12 well plate, or 6 well plate, anti evaporation film can be used, or self sealing bags or other appropriate materials can be used to cut circular plastic sheets slightly smaller than the holes. After adding TUNEL reaction solution dropwise, cover the sample to prevent the evaporation of TUNEL reaction solution and make the TUNEL reaction solution evenly cover the sample.b. Discard the TUNEL reaction solution, wash twice with PBS, and then wash three times with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mL BSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. (Optional) Add an appropriate concentration of 5 to each sample µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes. After staining, discard DAPI staining solution and wash twice with PBS for 5 minutes each time.d. (Optional) Slice sealing: Add 50 drops to each sample µ L anti fluorescence quenching sealing agent (anti fluorescence quenching sealing agent may not be suitable for certain dyes, it is recommended to conduct pre experimental testing for compatibility before the experiment), cover the cover glass, gently tap the cover glass with the blunt end of tweezers to remove bubbles and ensure complete sealing.e. Use filter paper to remove excess liquid and add 100 to the sample area µ Keep the sample moist with PBS and immediately observe under a fluorescence microscope.(3) For suspended cells or cell suspensionsa. Add 50 to each sample tube µ Gently resuspend cells in LTUNEL reaction solution and incubate at 37 ℃ in the dark for 30-1 hour. Gently resuspend cells with a micropipette every 15 minutes.b. Centrifuge at 2000 rpm for 5 minutes, discard TUNEL reaction solution, and wash twice with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mLBSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. Add 100 to each sample tube µ L concentration is 5 µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes.d. Join 400 µ L PBS resuspended cells and immediately detected with a flow cytometer or observed under a fluorescence microscope after smearing.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. when the staining background is heavy or non-specific staining is obvious, the staining time can be appropriately reduced. 3. it is recommended to add negative control and positive control groups during the experiment. 4. please wear mask and gloves when using component A. if it contacts the skin, please wash it with plenty of water immediately. 5. fluorescent dyes have quenching problems. Please try to avoid light to slow down fluorescence quenching. 6. for your safety and health, please wear experimental clothes and disposable gloves. Product parameters：590/617nm； Scope of application：Late apoptosis detection, TUNEL Kit... Read More | Format:2-ComponentEnzyme:Horseradish peroxidase | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |