| Description | Pyruvate Kinase (PK, EC 2.7.1.40) is widely present in animals, plants, microorganisms, and cultured cells. It catalyzes the final step of glycolysis and is one of the key rate-limiting enzymes in glycolysis, as well as a crucial enzyme for ATP production. Therefore, determining PK activity is of Pyruvate Kinase (PK, EC 2.7.1.40) is widely present in animals, plants, microorganisms, and cultured cells. It catalyzes the final step of glycolysis and is one of the key rate-limiting enzymes in glycolysis, as well as a crucial enzyme for ATP production. Therefore, determining PK activity is of significant importance.Detection Principle: PK catalyzes the conversion of phosphoenolpyruvate and ADP to ATP and pyruvate. Lactate dehydrogenase (LDH) further catalyzes the reaction of NADH and pyruvate to produce lactate and NAD⁺. The change in NADH absorbance at 340 nm is measured to calculate the PK activity in the sample.Applicable Samples: Animal/plant tissues, cells, bacteria, serum (plasma)A1501205Component48T96TStorageA1501205AExtraction Buffer60 mL60 mL×22-8℃A1501205BAssay Buffer12 mL24 mL2-8℃A1501205CSubstrate Mix1EA1EA-20℃. Store in the dark.A1501205DLDH10.2 µL20.4 µL2-8℃Please check the quantity of each component before the experiment.An additional 10% of each component is provided beyond the specified volume for standard curve preparation or preliminary experiments.User-Provided Instruments and ReagentsTypeNameNotesInstrumentMicroplate ReaderCapable of measuring absorbance at 340 nm.Consumables96-well UV PlateUV-transparent plate.ReagentsPBS (pH 7.4) / Deionized WaterFor washing cells/bacteria / Reagent preparation.OthersHomogenizer (for tissue samples), incubator, ice bucket, low-temperature centrifuge, adjustable pipettes and tipsUsing a multichannel pipette for large-scale detection can improve efficiency.Experimental Procedure1. Reagent PreparationReagent NameReagent PreparationPrecautionsExtraction BufferReady-to-use; equilibrate to room temperature before use.Store at 4°C.Assay BufferReady-to-use; equilibrate to room temperature before use.Store at 4°C.Substrate Mix Working ReagentPrepare before use: For 48T: Add 10.2 mL Assay Buffer and 0.6 mL deionized water to the vial. For 96T: Add 20.4 mL Assay Buffer and 1.2 mL deionized water to the vial. Dissolve thoroughly.After preparation, aliquot and store at -20°C for up to 6 months. Avoid repeated freeze-thaw cycles. Before use, incubate at 25°C (for general species) or 37°C (for mammals) for 5 min.LDH Working ReagentPrepare before use: For 48T: Add 0.6 mL deionized water to the LDH vial. For 96T: Add 1.2 mL deionized water to the LDH vial. Mix thoroughly.Keep on ice after preparation. The diluted reagent can be stored at 4°C for 1 month.2. Sample PreparationNote: Fresh samples are recommended. If not used immediately, samples can be stored at -80°C for up to 1 month.2.1 Animal/Plant Tissues: Weigh approximately 0.1 g of tissue, add 1 mL of Extraction Buffer, and homogenize on ice. Centrifuge at 8000 g, 4°C for 10 minutes. Collect the supernatant and keep on ice for detection.2.2 Cells/Bacteria: Collect 5×10⁶ cells or bacteria into a centrifuge tube. Wash with cold PBS, centrifuge, and discard the supernatant. Add 1 mL of Extraction Buffer. Disrupt by ultrasonic homogenization on ice (power 20% or 200 W, ultrasonicate for 3 s, interval 7 s, repeat 30 times). Centrifuge at 8000 g, 4°C for 10 minutes. Collect the supernatant and keep on ice for detection.2.3 Serum (Plasma) and other liquid samples: Detect directly.3. Assay Steps3.1 Microplate Reader Preparation: Preheat for at least 30 minutes. Set the wavelength to 340 nm.3.2 Assay System Setup: In a 96-well UV plate, add sequentially: 10 µL of sample, 10 µL of LDH Working Reagent, and 180 µL of Substrate Mix Working Reagent. Mix rapidly immediately after addition.3.3 Absorbance Measurement: Immediately after mixing, measure the absorbance at 340 nm at 20 seconds (A1) and then at 2 minutes and 20 seconds (A2). Calculate ΔA = A1 - A2.4. Result Calculation4.1 Data ProcessingCalculate ΔA = A1 - A2.4.2 Sample PK Activity Calculation(1) Based on sample mass:Unit Definition: One unit of enzyme activity is defined as the consumption of 1 nmol NADH per minute per gram of tissue in the reaction system.Formula:PK (U/g) = [ΔA×Vtotal reaction÷ (ε × d) × 10⁹] ÷ (Vsample ÷ Vtotal extract×W) ÷ T = 3215 × ΔA ÷ W(2) Based on cell/bacterial count:Unit Definition: One unit of enzyme activity is defined as the consumption of 1 nmol NADH per minute per 10⁴ bacteria or cells in the reaction system.Formula:PK (U/10⁴) = [ΔA × Vtotal reaction ÷ (ε × d) × 10⁹] ÷ (Vsample ÷ Vtotal extract; × 500) ÷ T = 3215 × ΔA ÷ 500 = 6.431 × ΔA(3) Based on liquid volume:Unit Definition: One unit of enzyme activity is defined as the consumption of 1 nmol NADH per minute per mL of serum (plasma) in the reaction system.Formula:PK (U/mL) = [ΔA × Vtotal reaction; ÷ (ε × d) × 10⁹] ÷ Vsample ÷ T = 3215 × ΔA(4) Based on protein concentration:Unit Definition: One unit of enzyme activity is defined as the consumption of 1 nmol NADH per minute per mg of protein in the reaction system.Formula:PK (U/mg prot) = [ΔA × Vtotal reaction; ÷ (ε × d) × 10⁹] ÷ (Cpr × Vsample ) ÷ T = 3215 × ΔA ÷ CprParameter Description:Vtotal reaction; : Total reaction volume, 2 × 10⁻⁴ Lε: Molar extinction coefficient of NADH, 6.22 × 10³ L/mol/cmd: Light path of the 96-well plate, 0.5 cm10⁹: Conversion factor (1 mol = 1 × 10⁹ nmol)Vsample : Volume of sample added, 0.01 mLVtotal extract; : Volume of Extraction Buffer added, 1 mLT: Reaction time, 2 minCpr: Sample protein concentration, mg/mLW: Sample mass, g500: Cell or bacterial count (5 × 10⁶), converted to units of 1Precautions1. It is recommended to perform preliminary experiments using 2-3 samples expected to have significant differences before formal testing.2. This kit is compatible with spectrophotometer detection. Adjust the preparation volume of detection reagents proportionally according to the spectrophotometer's requirements.3. For tissue and cell samples, results can be normalized by measuring the protein concentration. Aladdin BCA Protein Quantification Kit (B665595) or Ready-to-Use BCA Protein Quantification Kit (R1491648) are recommended.4. Biochemical reagents are generally irritating and biologically toxic. For your safety and health, please implement appropriate biosafety precautions throughout the experiment. Wear personal protective equipment such as lab coats, masks, gloves, and hair caps. Perform experiments in a fume hood or biosafety cabinet.5. This product is for scientific research use only. Not intended for clinical diagnosis.Frequently Asked QuestionsQ: What should I do if the sample ΔA is too high or too low?A: If the sample ΔA is > 1.0, the PK activity in the sample is too high. Dilute the sample appropriately with Extraction Buffer or reduce the amount of sample used for extraction, and then re-assay. If the sample ΔA is < 0.005, extend the reaction time to 5 or 10 minutes, or appropriately increase the sample amount, and then re-assay.Q: Will testing multiple samples simultaneously affect the results?A: Appropriately extending the time by 3-5 minutes for this assay will not affect the results. When testing multiple samples, it is recommended to use a multi-channel pipette for operation... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | O665690 Component 50T Storage O665690A DNase I 1000 U -20℃.Avoid freeze/thaw cycle. O665690B 10×Reaction Buffer 1000 µL -20℃.Avoid freeze/thaw cycle. O665690C Buffer RLS 40 mL RT O665690D Buffer RW1 40 mL RT O665690E Buffer RW2 (concentrate) 11 mL RT O665690F RNase-Free Water O665690 Component 50T Storage O665690A DNase I 1000 U -20℃.Avoid freeze/thaw cycle. O665690B 10×Reaction Buffer 1000 µL -20℃.Avoid freeze/thaw cycle. O665690C Buffer RLS 40 mL RT O665690D Buffer RW1 40 mL RT O665690E Buffer RW2 (concentrate) 11 mL RT O665690F RNase-Free Water 10 mL RT O665690G Spin Columns FS with Collection Tubes 50 EA RT O665690H Spin Columns RM with Collection Tubes 50 EA RT O665690I RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RTProduct IntroductionThis kit is suitable for extracting RNA from a wide range of plants, even from plants rich in polysaccharides and polyphenols, high quality RNA can be successfully extracted, such as rice leaves, wheat leaves, corn leaves, tobacco leaves, pine needles, ginkgo leaves, poplar leaves, pomegranate leaves, holly leaves, apples, peaches, pears, tomatoes, cherries, apricots, bananas, grapes, loquats, cinnamon rinds, cinnamon pulp, lychee fruit rinds, lychee pulp, soybean, peanut, corn, potato tuber, moonflower petal, pomegranate petal, shiitake mushroom, flat mushroom and other samples. The unique lysate formula can rapidly inactivate the RNA enzyme in the cell, effectively remove the effect of polysaccharide and polyphenol on RNA extraction, without the need for phenol, chloroform and other reagents, while using silicon matrix membrane adsorption of RNA for purification, the total RNA extracted is highly pure, without the contamination of genomes, proteins and other impurities, and can be used for Real Time RT-PCR, RT-PCR, It can be used for Real Time RT-PCR, RT-PCR, Northern Blot, Dot Blot, in vitro translation and other downstream experiments.RNA yieldSelf-contained reagents: β-mercaptoethanol, anhydrous ethanol (freshly opened or for RNA extraction)Pre-experiment Preparation and Important Notes1. To prevent RNase contamination, attention should be paid to the following aspects:1) Use RNase-free plastics and tips.(2) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.2. Avoid repeated freezing and thawing of the extracted samples, otherwise it will affect the rate and quality of RNA extraction.3. If Buffer RLS produces a precipitate, heat to dissolve it and leave at room temperature.4. Please add β-mercaptoethanol to Buffer RLS before use, add 20µl β-mercaptoethanol to 1ml Buffer RLS. Buffer RLS with β-mercaptoethanol can be stored for 1 month at room temperature.5. Anhydrous ethanol should be added according to the instructions on the reagent bottle label before using Buffer RW2 for the first time. Operation steps1. Homogenization: Take 50-100mg of plant tissue and quickly grind it into powder in liquid nitrogen, add 500µl of Buffer RLS (please check whether β-mercaptoethanol is added before use), and immediately mix it by vortexing with vigorous shaking.Note: For materials that are extremely rich in water content, such as watermelon pulp, tomato, pear pulp, etc., more material can be added appropriately, up to 200 mg; for starch-rich samples or mature leaves, the amount of Buffer RLS can be increased appropriately, up to 700 µl.2. Centrifuge at 12,000 rpm (~13,400 x g) for 2 min at 4°C.3. Transfer the supernatant into the filter columns (Spin Columns FS) that have been loaded into the collection tubes, centrifuge at 12,000 rpm at 4°C for 1 minute, carefully aspirate the supernatant in the collection tubes and transfer it to new RNase-Free centrifugation tubes (self-provided), avoiding the tip of the gun from touching the cell debris precipitation in the collection tubes as much as possible.4. Slowly add 0.5 times the volume of the supernatant in anhydrous ethanol, mix well (a precipitate may appear), and transfer the resulting solution together with the precipitate to a Spin Columns RM in a collection tube, or in two batches if you cannot add all of the solution at once. centrifuge the column for 1 minute at 12,000 rpm at 4°C. Dispose of the spent solution and place the column back into the collection tube. Centrifuge at 12,000 rpm for 1 minute at 4°C, discard the spent solution and return the column to the collection tube.5. Add 350 µl of Buffer RW1 to the adsorbent column RM, centrifuge at 12,000 rpm at 4°C for 1 min, discard the waste solution and put the adsorbent column back into the collection tube.6. Preparation of DNase I mixture: Take 52µl of RNase-Free Water, add 8µl of 10×Reaction Buffer and 20µl of DNase I (1U/µl) to it, mix well, and prepare a final volume of 80µl of reaction solution.7. Add 80µl of DNase I mixture directly to the adsorption column and incubate at 20-30°C for 15 minutes.8. Add 350 µl of Buffer RW1 to the adsorbent column RM, centrifuge at 12,000 rpm at 4°C for 1 min, discard the waste solution and put the adsorbent column back into the collection tube.9. Add 500 µl of Buffer RW2 to the adsorbent column RM (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 1 minute at 4°C, discard the waste solution and put the adsorbent column back into the collection tube.10. Repeat step 9.11. Centrifuge at 12,000 rpm for 2 minutes at 4°C.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (zymography, PCR, etc.).12. Load the adsorption column RM into new RNase-Free Centrifuge Tubes (1.5 ml), add 30-50 µl of RNase-Free Water dropwise to the middle part of the adsorption membrane overhang, leave it at room temperature for 2 min, and centrifuge at 12,000 rpm at 4°C for 1 min, and store the resulting RNA solution at -70°C to prevent degradation.Note: 1) The volume of RNase-Free Water should not be less than 30 µl, too small volume affects the recovery rate.2) If you want to increase the RNA yield, repeat step 12 with 30-50 µl of fresh RNase-Free Water.3) If the RNA concentration is to be increased, the resulting solution can be reintroduced into the adsorption column and step 12 repeated... Read More | Product content: U665923Component50 T200 TStorageU665923ABuffer GTL15 mL60 mLRTU665923BBuffer GL15 mL50 mLRTU665923CBuffer GW1 (concentrate)13 mL52 mLRTU665923DBuffer GW2 (concentrate)15 mL70 mLRTU665923EBuffer GE15 mL60 mLRTU665923FProteinase K1.25 mL4×1.25 mLRTU665923GSpin Columns DM with Product content: U665923Component50 T200 TStorageU665923ABuffer GTL15 mL60 mLRTU665923BBuffer GL15 mL50 mLRTU665923CBuffer GW1 (concentrate)13 mL52 mLRTU665923DBuffer GW2 (concentrate)15 mL70 mLRTU665923EBuffer GE15 mL60 mLRTU665923FProteinase K1.25 mL4×1.25 mLRTU665923GSpin Columns DM with Collection Tubes50 EA200 EART Product Introduction:This reagent kit is suitable for extracting high-purity total DNA from various samples such as fresh or frozen animal tissues, cells, blood, bacteria, etc. This product can purify DNA fragments with a maximum molecular weight of 50 kb. The purification process does not require the use of toxic solvents such as phenol or chloroform, nor does it require ethanol precipitation. This reagent kit adopts an optimized buffer system to efficiently and specifically bind DNA from the lysis solution to the silica matrix centrifuge adsorption column. Inhibitors of PCR and other enzymatic reactions can be effectively removed through a two-step washing step. Finally, high-purity DNA can be obtained by washing with low salt buffer or water. The purified DNA can be directly used for downstream experiments such as enzyme digestion, PCR, Real Time PCR, library construction, Southern Blot, and molecular labeling.Self prepared reagent: anhydrous ethanolEnzymatic Lysis Buffer (preparation required for extracting genomic DNA from Gram positive bacteria).Self prepared reagent: Enzymatic Lysis Buffer Formula: 20 mM Tris, pH 8.0; 2 mM Na2 EDTA; 1.2% Triton self prepared reagent: X-100; Lysozyme with a final concentration of 20 mg/mL.Preparation and important precautions before the experiment:1. Samples should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2.If extracting the genome of bacterial cultures with a large accumulation of secondary metabolites or thick cell walls, it is recommended to collect samples early in the logarithmic growth phase.3.Before the first use, anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in Buffer GTL and Buffer GL. If there is any crystallization or precipitation, please dissolve Buffer GL and Buffer GTL again in a 56 ℃ water bath.5. If downstream experiments are sensitive to RNA contamination, 4 can be added before adding Buffer GL µ RNase A of L DNase Free (100 mg/mL) was not provided in this kit.Operation steps：Genome extraction from blood and cell samples1. Material processing1a If the extracted material is mammalian anticoagulant blood (non nucleated red blood cells), it can be directly directed to 50-200 µ Add Buffer GTL to fresh or frozen anticoagulant blood samples to supplement up to 200 µ L;1b If the extracted material is anticoagulant blood from poultry, birds, amphibians, or lower level organisms, and their red blood cells are nucleated cells, take 5-10 µ L fresh or frozen anticoagulant blood samples, add Buffer GTL to supplement up to 200 µ L;1c The cells cultured on the wall should be first processed into a cell suspension (with a maximum extraction amount of 5 × 10 cells), centrifuged at 2000 rpm (400 × g) for 5 minutes, discarded from the supernatant, and added with 200 µ L GTL, oscillate until the sample is completely suspended;Note: To remove RNA, add 4 after completing the above steps µ RNase A solution with a concentration of 100 mg/mL was vortexed for 15 seconds and left at room temperature for 2 minutes.2. Add 20 µ L Protein K.3. Add 200 µ L Buffer GL, vortex oscillation thoroughly mixed, 56 ℃ water bath for 10 minutes.4. Temporarily centrifuge to remove water droplets from the inner wall of the tube cover. Join 200 µ L anhydrous ethanol, vortex and shake thoroughly to mix well. Short centrifugation.Attention: 1) After adding Bu ff er GL and anhydrous ethanol, immediately vortex shake and mix well.2) The addition of Bu ff er GL and anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments. Some organizations may form sol-gel products after adding Bu ff er GL and anhydrous ethanol, and it is recommended to perform severe shaking or vortex treatment at this time.5. Add all the solutions obtained in the previous step to the spin columns DM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm (~13400 × g) for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 7.8.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).9. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Attention:1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Preheating the GE in a water bath at 65-70 ℃ and incubating it at room temperature for 5 minutes before centrifugation can increase yield; Use an additional 50-200 µ Re washing with GE or sterilized water can increase yield.3) If the final concentration of DNA needs to be increased, the obtained solution can be re added to the adsorption column, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ Wash with GE or sterilized water.4) Because DNA stored in water is affected by acidic hydrolysis, if long-term preservation is required, it is recommended to elute with Bu ff er GE and store at -20 ℃.Genome extraction from animal tissues1. Material processingIf the extracted material is animal tissue, take 25 mg (the amount of spleen tissue should be less than 10 mg); If the material is mouse tail, take a section of rat tail with a length of 0.4-0.6 cm or two sections of mouse tail with a length of 0.4-0.6 cm.1a. After liquid nitrogen grinding or cutting the sample into small pieces, place it in a 1.5 mL centrifuge tube and add 180 mL µ Label different samples with L Buffer GTL.1b If using a homogenizer to process the sample, add no more than 80% of the homogenizer to the sample before homogenization µ L Buffer GTL, add 100 after homogenization µ L Buffer GTL.Attention:1) Ensure that the quantity of each organization does not exceed the recommended range.2) The tissue samples can be ground with liquid nitrogen or homogenized with a homogenizer before adding Bu ff er GTL, which can increase the cracking efficiency.2. Add 20 µ L Protein K, vortex oscillation thoroughly mixes the sample. Take a 56 ℃ water bath until the tissue is completely lysed. During the incubation process, the centrifuge tube can be inverted or shaken periodically to disperse the sample.Attention:1) The digestion time varies for different tissues, usually taking 1-3 hours to complete. The tail of the mouse needs to be digested for 6-8 hours, and if necessary, overnight digestion will not affect subsequent operations.2) If there is still gel like substance after incubation and vortex oscillation, extend the incubation time at 56 ℃ or add another 20 µ L Protein K digestion.3) To remove RNA, add 4 after completing the above steps µ RNase A solution with a concentration of 100 mg/mL, vortex for 15 seconds, and leave at room temperature for 5-10 minutes.3. Add 200 µ L Buffer GL, vortex shake thoroughly and mix well, take a water bath at 70 ℃ for 10 minutes. Add 200 after brief centrifugation µ L anhydrous ethanol, vortex and shake thoroughly to mix well.Attention:1) After adding Bu ff er GL and anhydrous ethanol, immediately vortex and shake to mix well.2) The addition of Bu ff er GL and anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments. Some tissues (such as the spleen and lungs) may form sol-gel products after adding Bu ff er GL and anhydrous ethanol. In this case, it is recommended to perform vigorous shaking or vortex treatment.4. Centrifuge briefly and add all the solution obtained in step 3 to the spin columns DM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm (~13400 × g) for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.5. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 6.7.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).8. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Attention:1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Preheating the GE in a water bath at 65-70 ℃ and incubating it at room temperature for 5 minutes before centrifugation can increase yield; Use an additional 50-200 µ Re washing with GE or sterilized water can increase yield.3) If the final concentration of DNA needs to be increased, the obtained solution can be re added to the adsorption column, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ Wash with GE or sterilized water.4) Because DNA stored in water is affected by acidic hydrolysis, if long-term preservation is required, it is recommended to elute with Bu ff er GE and store at -20 ℃. i ii Genomic extraction of blood and cell samples1. Bacterial sample pretreatment1a Gram negative bacteria(1) Take 1-5mL of bacterial culture (10 ^ -10 ^ cells, up to a maximum of 2 × 10 ^ cells) and place it in a centrifuge tube (self prepared). Centrifuge at 12000 rpm (~13400 × g) for 1 minute and try to aspirate the supernatant as much as possible.(2) Add 180 to the precipitate µ L Buffer GTL, shake to suspend bacterial weight.(3) Join 20 µ L Protein K, vortex mix well, incubate at 56 ° C until the bacterial cell is completely lysed, and during the incubation process, invert or shake the centrifuge tube periodically to disperse the sample.Note: To remove RNA, add 4 after completing the above steps µ L RNase A solution with a concentration of 100 mg/mL, shake well and let stand at room temperature for 5-10 minutes.(4) Join 200 µ L Buffer GL, vortex oscillation mixing.1b Gram positive bacteria(1) Take 1-5 mL of bacterial culture (10 ^ -10 ^ cells, maximum not exceeding 2 x 10 ^ cells) and place it in a centrifuge tube (self prepared). Centrifuge at 12000 rpm for 1 minute and try to aspirate the supernatant as much as possible.(2) Join 180 µ L Enzymatic Lysis Buffer (self provided) suspends the bacterial weight.(3) Incubate at 37 ℃ for 30 minutes.(4) Join 20 µ L Protein K vortex oscillation, thoroughly mixed. Join 200 µ L Buffer GL, vortex oscillation mixing. Incubate at 56 ℃ for 30 minutes.Attention:1) If necessary, incubation at 95 ° C for 15 minutes can inactivate the pathogen, but incubation at 95 ° C can cause some DNA degradation.2) To remove RNA, add 4 after completing the above steps µ L RNase A solution with a concentration of 100 mg/mL, shake well and let stand at room temperature for 5-10 minutes.2. Add 200 µ L anhydrous ethanol, vortex and shake thoroughly to mix well.Attention: Adding anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments.3. Add all the solution obtained from step 2 (including the formed precipitate) to the adsorption column (Spin Columns DM) that has been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.4. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.5. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 5.6.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).7. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Attention:1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Preheating the GE in a water bath at 65-70 ℃ and incubating it at room temperature for 5 minutes before centrifugation can increase yield; Use an additional 50-200 µ Re washing with GE or sterilized water can increase yield.3) If the final concentration of DNA needs to be increased, the obtained solution can be re added to the adsorption column, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ Wash with GE or sterilized water.4) Because DNA stored in water is affected by acidic hydrolysis, if long-term preservation is required, it is recommended to elute with Bu ff er GE and store at -20 ℃... Read More |