| Description | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | FFPE DNA/RNA KitFixed Tissue DNA/RNA Extraction Kit Catalog number: F666120 (50 preps)Storage conditions: DNase I and 10×Reaction Buffer -20℃, Spin Columns DF and Spin Columns RS can be stored at room temperature for 2 months, 2-8℃ for 1 year, the rest of the components are stored FFPE DNA/RNA KitFixed Tissue DNA/RNA Extraction Kit Catalog number: F666120 (50 preps)Storage conditions: DNase I and 10×Reaction Buffer -20℃, Spin Columns DF and Spin Columns RS can be stored at room temperature for 2 months, 2-8℃ for 1 year, the rest of the components are stored at room temperature (15-30℃).Products Content:Products IntroductionThis kit is suitable for the effective purification of genomic DNA and total RNA from paraffin-embedded tissues, using specially optimized deparaffinizing agents and lysates to release DNA and RNA from tissue section samples, without the use of the organic reagent xylene, and without the need for overnight operation; the digested samples are incubated at higher temperatures to remove inhibitors caused by cross-linking, which can effectively improve nucleic acid yields and purity; and an optimized buffer system allows nucleic acids in the lysate to bind specifically to the adsorbent membrane, and inhibitors are effectively removed by a two-step rinsing procedure. The optimized buffer system enables the nucleic acids in the lysate to bind specifically to the adsorbent membrane, and the inhibitors are effectively removed by a two-step rinsing step, and finally eluted with low-salt buffer or water to obtain high purity DNA and RNA, and at the same time, equipped with a high-efficiency microsorbent column, the volume of the elution can be as low as 20 µl. The purified DNA and RNA can be directly used for PCR, Real-time PCR, SNP genotyping, STR genotyping, and so on. The purified DNA and RNA can be directly used for PCR, Real-time PCR, SNP genotyping, STR genotyping, second-generation sequencing, pharmacogenomics research and blot analysis.Self-contained reagent: anhydrous ethanolPre-experiment Preparation and Important Notes 1. After obtaining the sample, fix the sample as soon as possible, the fixation time of 14-24 hours is appropriate, too long a period of time will easily lead toDNA and RNA breaks, affecting downstream experiments. If the formaldehyde fixation time is too long or the sample is stored for too long(>1 year) is prone to compromise DNA integrity and failure to amplify long fragments.2. Ensure that samples are thoroughly dehydrated prior to embedding; residual formalin will inhibit Proteinase K action.3. Add 1.25 ml of Proteinase K Storage Buffer to Proteinase K to dissolve it, and store at -20℃. Do not leave the prepared Proteinase K at room temperature for a long period of time to avoid affecting its activity.4. Anhydrous ethanol should be added to Buffer RW2, Buffer GW1 and Buffer GW2 according to the label instructions on the vials before first use.5. Check Buffer GTL, Buffer GL and Buffer DS for crystallization or precipitation prior to use; if crystallization or precipitation occurs, redissolve Buffer GTL, Buffer GL and Buffer DS in a 37°C water bath.6. Preheat the water bath or thermostatic mixer to 56°C before starting the experiment.7. Use an ambient temperature centrifuge or set the centrifuge temperature to 25°C. Temperatures below 15°C may result in clogging of the adsorption column.8. To prevent RNase contamination, the following should be observed:1) Use RNase-free plastics and tips to avoid cross-contamination.(2) Glassware should be dry baked at 180°C for 4 hours before use, plasticware can be soaked in 0.5 M NaOH for 10 minutes, rinsed thoroughly with water and autoclaved.3) RNase-free water should be used to prepare the solution.(4) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.procedureParaffin-embedded samples1. Trim off excess paraffin from the tissue block to expose the tissue and cut into 5-10 µm slices.2. Place approximately 1 x 1 cm2 slices (1-5 slices in total) in a centrifuge tube (supplied), add 500 µl of Buffer DS and vortex for 10 s. Briefly centrifuge the sample to the bottom of the tube. Centrifuge briefly to collect the sample at the bottom of the tube, incubate at 56°C for 3 minutes, remove from the water bath and allow to cool to room temperature before proceeding.Note: If the surface of the sample is exposed to air, discard the initial 2-3 slices without using them.3. Centrifuge at 12,000 rpm for 2 minutes and carefully discard the supernatant thoroughly without aspirating the precipitate. The residual dewaxing solution can be carefully removed with a small tip (10 µl).4. Add 180 µl of Buffer GTL and 20 µl of Proteinase K to the above tube and mix well with vortexing.5. Incubate at 56°C for 15 minutes, then place on ice for 3 minutes. Centrifuge at 12,000 rpm for 15 minutes at room temperature.6. Transfer the supernatant to a new 1.5 ml centrifuge tube for RNA extraction, taking care not to aspirate undigested tissue. Use the precipitate for DNA extraction. RNA extraction7. Take the supernatant obtained in step 6 and incubate at 80°C for 15 minutes.8. Add 320 µl of Buffer GL, mix by vortexing and shaking, then add 720 µl of anhydrous ethanol and mix immediately by vortexing and shaking.9. Add all of the resulting solution to the Spin Columns RS in the collection tube; if the solution cannot be added all at once, it may be transferred in several passes. centrifuge the column at 12,000 rpm for 1 minute, pour off the waste solution from the collection tube, and place the column back into the collection tube. Note: If the columns are clogged, the sample size may be too large and consideration should be given to reducing the number of starting sections to 1-2.Optional step: If genomic DNA is to be removed, the following steps can be followeda. Add 350 µl of Buffer RW1 to the column, centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and place the column back into the collection tube.b. Preparation of DNase I mixture: Take 52 µl of RNase-Free Water and add 8 µl of 10×Reaction to it.Buffer and 20 µl DNase I (1 U/µl), mix well, and prepare a final volume of 80 µl of reaction solution.c. Add 80 µl of DNase I Mix directly to the adsorption column and incubate at 20-30°C for 15 minutes.d. Add 350 µl of Buffer RW1 to the column, centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and return the column to the collection tube.Add 500 µl of Buffer RW2 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.11. Repeat step 10. centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Place the column at room temperature for 5 minutes.minutes to dry thoroughly.12. Place the column in a new RNase-free centrifuge tube and add 20-50 µl to the center of the column.RNase-Free Water, left at room temperature for 5 minutes, centrifuged at 12,000 rpm for 1 minute, and collected RNA solution, the-80°C for storage.DNA extraction7. Take the precipitate obtained in step 6 and add 180 µl Buffer GTL and 20 µl Proteinase K to the precipitate. VortexResuspend the precipitate for 15 seconds.8. Incubate at 56°C for 1 hour until the sample is completely dissolved. 90°C for 1 hour.Add 200 µl Buffer GL, vortex and shake to mix and then add 200 µl anhydrous ethanol, vortex and shake to mix thoroughly. Centrifuge briefly so that the solution on the wall of the tube collects at the bottom of the tube. Add all of the solution from step 9 to the Spin Columns DF in the collection tube, or transfer the solution in several passes. centrifuge at 12,000 rpm for 1 minute, pour off the waste solution from the collection tube, and return the column to the 10. collection tube.Note: If the adsorption column is clogged, the sample size may be too large and consideration should be given to reducing the number of starting sections to 1-2.11. Add 500 µl of Buffer GW1 to the adsorbent column and centrifuge at 12,000 rpm for 1 minute. Pour off the waste liquid from the collection tube and put the column back into the collection tube.12. Add 500 µl of Buffer GW2 to the adsorbent column and centrifuge at 12,000 rpm for 1 minute. Pour off the waste liquid from the collection tube and place the column back into the collection tube.Note: Step 12 may be repeated if further purity is required.13. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for 5 minutes to dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorbent column; ethanol residue will affect the subsequent enzymatic reaction. 14. Place the column in a new 1.5 ml centrifuge tube, add 20-50 µl Buffer EB to the center of the column, leave at room temperature for 5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store at -20℃... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionThe Universal Coupling Kit makes particle-based immunoassays, lateral flow tests and biomolecule separation applications more flexible than ever before. It is the only kit that allows users to select and couple their choice of carboxylated particle with their chosen protein.Employing a DescriptionThe Universal Coupling Kit makes particle-based immunoassays, lateral flow tests and biomolecule separation applications more flexible than ever before. It is the only kit that allows users to select and couple their choice of carboxylated particle with their chosen protein.Employing a unique mechanism to immobilise proteins, Anteo′s advantages outweigh those of conventional covalent chemistries such as NHS/EDC or passive binding. This facilitates coupling of antibodies with ease, improved functionality and reproducibility, leading to better uniformity between experiments.Anteo′s Activation Reagent is water-based and replaces the dry chemicals you would use with the traditional NHS/EDC method. Our One-Step-Activation only takes one hour, and improves efficiency in terms of both time and cost. It also provides the ability to either store activated particles up to 12 months for later use, or to immediately couple proteins.Particle-Based Immunoassays, Lateral Flow, Bioseparations and Immunoprecipitation... Read More | V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes 50 RT V669947H RNase-Free Centrifuge Tubes (1.5 mL) 50 RTProductsThis kit is suitable for the extraction of viral RNA and DNA from fresh or frozen plasma, serum and cell-free body fluids. It is easy to operate as it does not require the use of organic solvents such as phenol and chloroform for extraction. The kit uses a unique buffer system to enable efficient and specific binding of viral nucleic acids in lysate to silica gel centrifugal adsorption columns. Inhibitors of PCR and enzyme reactions as well as residual impurities can be efficiently removed in a two-step effective rinsing step, and finally high purity viral nucleic acids can be obtained by using a low-salt buffer or water for elution. The purified viral nucleic acid is free of protein, nuclease and other impurities, and can be used directly in PCR, RT-PCR, Real-Time PCR, blotting experiments and so on.Self-contained reagent: anhydrous ethanol.Pre-experiment and Important Notes1. Add 1.25ml Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time, and avoid repeated freezing and thawing to avoid affecting its activity. Do not add Proteinase K directly into Buffer GL.2. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller DNA fragments and a decrease in the amount of extracted DNA.3. Avoid repeated freezing and thawing of serum or plasma, which can lead to protein denaturation or precipitation, reducing the viral titer and thus affecting the yield of extracted viral nucleic acids.4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the label instructions of the reagent bottle before first use.5. Check Buffer GL for crystallization or precipitation before use. If crystallization or precipitation occurs, redissolve Buffer GL in a water bath at 56℃.Procedure1. Take a 1.5 ml centrifuge tube (self-provided) and add 20 µl Proteinase K.2. Add 200 µl serum or plasma to the centrifuge tube. Add 200µl Buffer GL and vortex and shake for 15 seconds.Note: 1) Sample volume less than 200 µl can be made up by adding 0.9% NaCl (self-provided). 2) In order to ensure effective lysis of the sample, the sample needs to be mixed well with Buffer GL after adding Buffer GL.3. Incubate at 56°C for 15 minutes, centrifuge briefly, and collect the solution from the wall of the tube to the bottom of the tube.4. 250 µl of anhydrous ethanol was added, vortexed and shaken for 15 seconds, left at room temperature for 5 minutes, centrifuged briefly, and the solution on the wall of the tube was collected at the bottom of the tube.Note: If the ambient temperature exceeds 25°C, anhydrous ethanol should be used after pre-cooling on ice.5. Add the solution obtained in step 4 to the adsorbent column (RNase-Free Columns RS) that has been loaded into the collection tube, and if the solution cannot be added at one time, it can be transferred in several times. centrifuge the column at 12,000 rpm (~13,400 × g) for 1 min, pour off the waste liquid in the collection tube, and put the column back into the collection tube.6. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.7. Add 500 µl of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 7 can be repeated if further DNA purity is required.8. Add 500 µl of anhydrous ethanol to the adsorbent column and centrifuge at 12,000 rpm for 1 min. Pour off the waste liquid in the collection tube and put the adsorbent column back into the collection tube.9. Centrifuge at 12,000 rpm for 3 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is the removal of residual ethanol from the adsorbent column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).10. Place the adsorption column in a new collection tube (RNase-Free Centrifuge Tube), add 20-150 µl of Buffer RE or sterilized water overhanging the middle of the adsorption column membrane, leave it at room temperature for 2-5 minutes, and then centrifuge it at 12,000 rpm for 1 minute to collect the nucleic acid solution.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on the elution efficiency, if water is used as the eluent it should be ensured that its pH is 7.0-8.5 (the pH of water can be adjusted to this range with NaOH), and the elution efficiency is not high when the pH is lower than 7.0.(2) For long-term storage, please store the DNA solution at -20℃ and the RNA solution at -70℃.3) If the final concentration of DNA/RNA is to be increased, the DNA/RNA eluate obtained in step 10 can be re-spiked onto the adsorbent membrane and step 10 repeated... Read More |