| Description | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Product Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 andProduct Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 and α1-4 fucosyl linkages in these substrates without the need to remove sialic acid moieties.For removing core fucose linked α-(1-6) to the core GlcNAc of a GlcNAc-GlcNAc disaccharide structure we recommend our Alpha-(1-6) Fucosidase.• Non-sialidase dependant hydrolysis of antennary fucose moieties• Effective on both glycopeptides and free glycans• Highly specific (α1-3,4 fucosylated glycans)• Kit includes enzyme plus reaction buffer.• Sufficient for up to 50 samplesα(1-3,4) Fucosidase is useful for:nbsp;nbsp;Fucose linkage determinationnbsp;nbsp;Deglycosylating glycoproteins with Lewis structuresContentsAlpha-(1-3,4)-Fucosidase – 200 mM citrate buffer pH 6 containing 250 mM NaCl5x Reaction Buffer – 250 mM sodium phosphate pH 6... Read More | Calcium, the most abundant mineral in the human body, is a crucial intracellular element that is responsible for regulating many physiological and pathological processes. Calcium is found in either the free ion form or in bound complexes, for example the calcium phosphate and calcium carbonate Calcium, the most abundant mineral in the human body, is a crucial intracellular element that is responsible for regulating many physiological and pathological processes. Calcium is found in either the free ion form or in bound complexes, for example the calcium phosphate and calcium carbonate complexes that make up bone tissue. Numerous physiological processes, including muscle contraction, cell adhesion, hormones/ neurotransmitters release, glycogen metabolism, cell proliferation/differentiation, blood clotting, nerve or synapthetic impulse transmission, and structural support of the skeleton are regulated by calcium signaling. Defects in the integrity of cell-specific calcium signaling systems may be associated with certain human diseases.Calcium Colorimetric Assay kit has been used to measure calcium concentration in hippocampal samples and MC3T3-E1 mouse osteoblast cell line, which were cultured in osteogenic induction medium... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product introduction：This kit uses an improved SDS alkaline lysis method combined with DNA preparation membrane to selectively adsorb DNA to achieve the purpose of rapid purification of plasmid DNA. It is suitable for extracting up to 100u of high-purity plasmid DNA from 30-100 ml of Product introduction：This kit uses an improved SDS alkaline lysis method combined with DNA preparation membrane to selectively adsorb DNA to achieve the purpose of rapid purification of plasmid DNA. It is suitable for extracting up to 100u of high-purity plasmid DNA from 30-100 ml of bacterial culture for sequencing, in vitro transcription and translation, restriction enzyme digestion, bacterial transformation and other molecular biology experiments.Scope of application：Nucleic acid extraction and purification... Read More |