| Description | Lactic acid is an important intermediate product in the metabolic processes of organisms, closely related to carbohydrate metabolism, lipid metabolism, protein metabolism, and intracellular energy metabolism. Lactic acid concentration is a key indicator for evaluating glycogen metabolism and aerobicLactic acid is an important intermediate product in the metabolic processes of organisms, closely related to carbohydrate metabolism, lipid metabolism, protein metabolism, and intracellular energy metabolism. Lactic acid concentration is a key indicator for evaluating glycogen metabolism and aerobic metabolism. Abnormally high concentrations of lactic acid are associated with pathological conditions such as cancer, diabetes, and lactic acidosis.The detection principle of this kit is as follows: Lactate dehydrogenase catalyzes the conversion of L-lactate to pyruvate, simultaneously reducing NAD+ to NADH and H+. Further, through the hydrogen transfer action of 1-mPMS, WST-8 reacts to form a yellow, soluble formazan. The absorbance at 450 nm is measured to calculate the L-lactate content in the sample.Detection Range: 0.03-2 mMSensitivity: 0.03 mMApplicable Samples: Animal and plant tissues, cells, bacteria, serum (plasma), or other liquids.L1501211Component48T96TStorageL1501211ALactate Assay Buffer70 mL70 mL×22-8℃L1501211BLactate Dehydrogenase0.7 mL1.4 mL-20℃L1501211CLactate Dehydrogenase Cofactor0.5 mL1 mL-20℃L1501211DWST-8350 µL700 µL-20℃. Store in the dark.L1501211EEnhancer70 µL140 µL-20℃. Store in the dark.L1501211FL(+)-Lactate Standard (100 mM)50 µL100 µL-20℃Please check the quantity of each component before the experiment.An additional 10% of each component is provided beyond the specified volume for standard curve preparation or preliminary experiments.User-Provided Instruments and ReagentsTypeNameNotesInstrumentMicroplate ReaderCapable of measuring absorbance at 450 nm.Consumables96-well MicroplateStandard transparent plate.ReagentsPBS (pH 7.4)For washing samples.OthersHomogenizer (for tissue samples), incubator, ice machine, low-temperature centrifuge, adjustable pipettes and tipsUsing a multichannel pipette for large-scale detection can improve efficiency.Experimental Procedure1. Reagent PreparationReagent NameReagent PreparationPrecautionsLactate Assay BufferReady-to-use; equilibrate to room temperature before use.4℃保存 Store at 4°C.Lactate DehydrogenaseReady-to-use;Keep on ice during the experiment; store aliquots at -20°C.Lactate Dehydrogenase CofactorReady-to-use;Keep on ice during the experiment; store aliquots at -20°C.WST-8Ready-to-use;Keep on ice during the experiment; store aliquots at -20°C.EnhancerReady-to-use;Keep on ice protected from light during the experiment; store aliquots at -20°C protected from light.L(+)-Lactate Standard (100 mM)Equilibrate to room temperature before use.100 mM, store aliquots at -20°C.2. Standard PreparationAdd 20 µL of the 100 mM standard to 980 µL of Lactate Assay Buffer to prepare a 2 mM standard stock solution. Aliquot and store at -20°C for up to 6 months. Dilute the 2 mM standard stock solution sequentially with Lactate Assay Buffer to prepare standard working solutions with final concentrations of 1 mM, 0.5 mM, 0.25 mM, 0.125 mM, 0.0625 mM, and 0.03125 mM. Use Lactate Assay Buffer as the blank.Standard Working SolutionStandard (µL)Lactate Assay Buffer (µL)Concentration (mM)1200 µL of 2 mM022200 µL of 2 mM20013200 µL of 1 mM2000.54200 µL of 0.5 mM2000.255200 µL of 0.25 mM2000.1256200 µL of 0.125 mM2000.06257200 µL of 0.0625 mM2000.03125Blank020003. Sample PreparationNote: Fresh samples are recommended. If not used immediately, samples can be stored at -80°C for up to 1 month. NADH or NADPH present in cell or tissue extracts can create background for lactate assay. To remove NADH or NADPH background, an equal amount of sample can be assayed without lactate dehydrogenase, and the background reading should be subtracted from the lactate reading. Endogenous lactate dehydrogenase (LDH) can degrade lactate. Samples containing LDH (e.g., cell culture medium, cell or tissue lysates) should be processed using a 10 kDa MW cutoff ultrafiltration tube (centrifuge at 12,000 g, 4°C for 10 min; follow the filter instructions) to remove all proteins. Use the filtrate for detection, then store at -80°C.3.1 Animal/Plant Tissues: Weigh approximately 0.1 g of tissue sample, add 1 mL of Lactate Assay Buffer, and homogenize on ice. Centrifuge at 12,000 g, 4°C for 5 min. Transfer the supernatant to a new tube and keep on ice for detection.3.2 Cells or Bacteria: Collect 5×10^6 cells. Wash the cells or bacteria with pre-cooled PBS. Centrifuge at 800 g for 2 min, discard the supernatant. Add 1 mL of Lactate Assay Buffer, and disrupt using an ultrasonic homogenizer on ice for 5 min (power 20% or 200 W, ultrasonic 3 s, interval 7 s, repeat 30 times). Centrifuge at 12,000 g, 4°C for 5 min. Collect the supernatant and keep on ice for detection.3.3 Plasma and Serum (Other Biological Fluids): Detect directly.4. Experimental Steps4.1 Microplate Reader Preparation: Preheat for at least 30 minutes, set wavelength to 450 nm.4.2 Working Reagent Preparation: 50 µL of Working Reagent is required per well. To avoid loss, prepare for 55 µL per single well system: Pipette 31 µL Lactate Assay Buffer, 8 µL Lactate Dehydrogenase Cofactor, 5 µL WST-8, 1 µL Enhancer, and 10 µL Lactate Dehydrogenase. Mix well. The Working Reagent must be prepared freshly and used immediately.4.3 Assay System Setup: Set up the detection system in the microplate according to the table below. The standard curve generally needs to be performed only once.ReagentStandard Well (µL)Test Well (µL)Sample050Standard Working Solution500Working Reagent50504.4 Absorbance Measurement: Mix well and incubate at 37°C protected from light for 30 min. Read the absorbance at 450 nm, recorded as Ablank, Astandard, and Atest. 5. Result CalculationThe following provides both the derived formula and the simplified calculation formula, which are completely equivalent.5.1 Data ProcessingCalculate ΔAstandard= Astandard- Ablank, ΔAtest = Atest - Ablank.5.2 Standard Curve PlottingPlot the standard curve with standard concentration as the y-axis and ΔAstandard as the x-axis. Substitute ΔAstandard into the equation to obtain the y value (mM).5.3 Sample L-Lactate Content Calculation① Calculated based on sample weight:L-Lactate (µmol/g) = y × Vsample ÷ (W × Vsample ÷ Vtotal) × n = y ÷ W × n② Calculated based on cell or bacterial count:L-Lactate (µmol/10⁴ cells) = y × Vsample ÷ (500 × Vsample ÷ Vtotal) × n = y ÷ 500 × n③ Calculated based on liquid volume:L-Lactate (mM) = y × Vsample ÷ Vsample × n = y × n④ Calculated based on protein concentration:L-Lactate (µmol/mg prot) = y × Vsample ÷ (Vsample × Cpr) × n = y ÷ Cpr × nParameter Description:1 mM = 1 mmol/L;Vsample : Volume of sample added, 0.05 mL;n: Sample dilution factor;Cpr: Sample protein concentration, mg/mL;W: Sample weight, g;Vtotal: Total volume of sample extract, 1 mL;500: Cell or bacterial count, 5×10⁶, converted to units of 10⁴.Result Presentation Using Previous Standard CurveTypical Standard Curve: y = 2.2613x - 0.0531Example-1: 50 µL of chicken serum was taken and processed according to the assay steps using a 96-well plate. The measured ΔAtest = Atest - Ablank= 0.435 - 0.096 = 0.339. Substituting into the standard curve, y = 0.713 mM. Calculated based on liquid volume: Lactate content (mM) = y × n = 0.713 × 5 = 3.565 mM.PrecautionsIt is recommended to perform preliminary experiments using 2-3 samples expected to have significant differences before formal testing.For tissue and cell samples, results can be normalized by measuring the protein concentration.This kit is compatible with spectrophotometer detection. Adjust the preparation volume of detection reagents proportionally according to the spectrophotometer's requirements.It is recommended to establish your own standard curve for improved accuracy. If not, you may refer to the typical standard curve formula provided in the results section for calculation.Biochemical reagents are generally irritating and biologically toxic. For your safety and health, please wear appropriate personal protective equipment (lab coat, mask, gloves, hair cap, etc.) throughout the experiment and perform experiments in a fume hood or biosafety cabinet.This product is for scientific research use only. Not intended for clinical diagnosis.Frequently Asked QuestionsWhat should I do if the sample ΔAtest is too high or too low?If the sample ΔAtest is >1.0, the lactate content in the sample is too high. Dilute the sample appropriately with Lactate Assay Buffer (multiply by the dilution factor in the calculation). If the sample ΔAtest is <0.13, increase the sample amount... Read More | This product can rapidly, gently, and efficiently lyse mammalian cells, effectively extracting cytoplasmic and nuclear proteins. This reagent uses a mild formula to ensure that the extracted protein maintains biological activity and can be applied to various protein analysis experiments, such as This product can rapidly, gently, and efficiently lyse mammalian cells, effectively extracting cytoplasmic and nuclear proteins. This reagent uses a mild formula to ensure that the extracted protein maintains biological activity and can be applied to various protein analysis experiments, such as reporter gene and enzyme activity determination, immune detection, protein purification, etc. The extracted protein can be quantitatively analyzed using the BCA method. The reagent kit contains a mixture of protease inhibitors, which can effectively prevent protein degradation during the protein extraction process.M665813Component100 TStorageM665813AMammalian Protein Extraction Reagent100 mLRTM665813BProtease Inhibitor Cocktail (100×)1 mL-20℃. Avoid freeze/thaw cycle. precautions1. This product can effectively lyse adherent cells cultured on cell culture plates (without scraping) and suspended cells collected by centrifugation, with higher extraction efficiency than repeated freeze-thaw or ultrasound methods. But for the extraction of tissue proteins, it is recommended to use the tissue protein extraction kit (CW0891).The optimal dosage for protein extraction from adherent cells is listed in Table 1. Collecting cells first can reduce the amount of reagents used to obtain higher protein concentrations.3. The amount of extraction reagents used can also be estimated based on the number of cells. If 2 × 106 Hela cells weigh about 20 mg, 200 need to be added µ Extract reagents.4. The protein extracted from this product can be quantitatively analyzed using the BCA method.Operation steps● Protein extraction from adherent cells1. Please remove the required Mammalian Protein Extraction Agent for pre cooling before protein extraction.2. Carefully pour out the culture medium of adherent cells and rinse the cells with PBS.3. Add an appropriate amount of Mammalian Protein Extraction Reagent (add Protein Inhibitor Cocktail in a 1:99 ratio 2-3 minutes before protein extraction), blow adherent cells on ice with a gun tip, transfer the lysate to a centrifuge tube, incubate on ice for 20 minutes, and allow the cells to fully lyse (please refer to Appendix 1 for the amount of reagent used, and the time for placing on ice should be adjusted according to different cell types). 4. Centrifuge at 14000 × g for 5-10 minutes.5. Transfer the supernatant to a new tube for further analysis. ● Suspension cell protein extraction1. Please remove the required Mammalian Protein Extraction Agent for pre cooling before protein extraction.2. Suspend 2500 × g of cells, centrifuge for 10 minutes, and discard the supernatant. Rinse cells with PBS. 2500 × g, centrifuge for 10 minutes, discard the supernatant.3. Add an appropriate amount of Mammalian Protein Extraction Agent, and 2-3 minutes before protein extraction, add Protein Inhibitor Cocktail in a ratio of 1:99, which is 1 x working solution.4. Add at least 1 ml of 1x working solution to every 100 mg of cells. If the extracted sample size is large, a small amount of 1x working solution can be used to resuspend the cells first, and then the remaining working solution can be added.5. After blowing evenly, place it on ice for 20 minutes to allow the cells to fully lyse (the time for placing it on ice should be adjusted according to different cell types). 6. Centrifuge at 14000 × g for 15 minutes.7. Transfer the supernatant to a new tube for further analysis.Table 1. Recommended usage of extraction reagents Cell culture plate type or dish type Extraction reagent usage 100 mm 500-1,000 µl 60 mm 250-500 µl 6-well culture plate 200-400 µl /well 24-well culture plate 100-200 µl /well 96-well culture plate 50-100 µl /well Table 2. Common Problems and Solutions Problem Possible reasons Resolvent Low extraction rate Low protein expression level Optimize transfection system Low extraction rate Insufficient reagent usage Increase the usage of extraction reagents Low extraction rate Reagent unable to dissolve cell membrane Increase cracking time or increase shaking amplitude Unable to obtain membrane protein This product is more suitable for extracting nuclear plasma protein Using eukaryotic cell membrane protein extraction kit... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product content: S665546Component50 TStorageS665546ABuffer QSL45 mLRTS665546BBuffer RIL11 mL2-8℃S665546CBuffer ML10 mLRTS665546DBuffer GW1 (concentrate)13 mLRTS665546EBuffer GW2 (concentrate)26 mLRTS665546FBuffer EBL13 mLRTS665546GRNase A240 µLRTS665546HLysis Tubes Ⅱ50 Product content: S665546Component50 TStorageS665546ABuffer QSL45 mLRTS665546BBuffer RIL11 mL2-8℃S665546CBuffer ML10 mLRTS665546DBuffer GW1 (concentrate)13 mLRTS665546EBuffer GW2 (concentrate)26 mLRTS665546FBuffer EBL13 mLRTS665546GRNase A240 µLRTS665546HLysis Tubes Ⅱ50 EARTS665546ISpin Columns DM With Collection Tubes50 EARTProduct IntroductionThis kit provides a method for extracting total DNA from soil or fecal samples, including the total DNA of cells, bacteria, parasites, and viruses in the samples. It is also suitable for extracting DNA from samples containing high concentrations of PCR reaction inhibitors. This reagent kit adopts a unique buffering system to efficiently bind DNA from the lysis solution to the adsorption column. Inhibitors of PCR and enzyme reactions, as well as residual impurities, can be effectively removed through washing steps. Finally, high-purity DNA can be obtained by washing with low salt buffer or water. The purified DNA can be directly used for downstream experiments such as second-generation sequencing (16S amplicons and metagenomes), library construction, PCR, qPCR, Southern Blot, enzyme digestion molecular markers, etc.Self prepared reagents1. Constant temperature mixer - Product number: CW25932. Anhydrous ethanol, isopropanol3. Vortex oscillator or tissue grinderPreparation and important precautions before the experiment1. Samples should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2.Before the first use, anhydrous ethanol should be added to Buffer GW1 (concentrate) and Buffer GW2 (concentrate) according to the instructions on the reagent bottle label.3. Take out the buffer RIL before use and store it at 2-8 ℃ immediately after use.Operation steps1. Centrifuge the Lysis Tube briefly to allow the beads to settle at the bottom.2. a. Add 0.1-0.3 g of soil or fecal sample to Lysis Tube, and add 740-820 µ L Buffer QSL and 4 µ L RNase A, tighten the tube cover and briefly vortex to mix.b. If fecal samples are stored in non lytic fecal preservation solutions (such as CWY041S and CWY041M), add 200 to Lysis Tube µ L-600 µ L solid-liquid mixture, centrifuge at 13000 rpm for 1 minute, discard the storage solution (if the amount of solid after centrifugation is too small, it can be enriched again, but should not exceed 0.3g). Join 620 µ LBuffer QSL and 4 µ L RNase A, tighten the tube cover and briefly vortex to mix.3. Fix the Lysis Tube in an oscillating grinding device equipped with a 2 mL adapter and process it according to the optimized grinding conditions of your equipment (see appendix).4. Shake the Lysis Tube on a constant temperature mixer at 70 ℃ and 1200 rpm for 10 minutes. Subsequently, centrifuge at 13000 rpm for 2 minutes to precipitate solid particles. Transfer 540 µ Transfer the supernatant to a new 2 mL centrifuge tube.5. Add 180 µ L Buffer RIL, vortex for 5 seconds, centrifuge at 13000 rpm for 2 minutes.Attention: Remove the buffer RIL before use and store it at 2-8 ℃ immediately after use.6. Add 160 to the new centrifuge tube in sequence µ L Buffer ML, 480 µ Supernatant from step 5, 320 µ L isopropanol, vortex for 5 seconds.7. Transfer the solution from the previous step to 650 µ Centrifuge at 12000 rpm (~13400 × g) for 1 minute into the spin columns DM that have been loaded into the collection tube.8. Discard the waste liquid in the collection pipe and place the adsorption column back into the collection pipe. Repeat step 7 until all the solution has been transferred.9. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.10. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. 11. Repeat step 10.12.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).13. Place the adsorption column in a new centrifuge tube (self provided) and add 50-200 drops of suspended droplets to the middle of the adsorption column µ L Buffer EBL or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Note: 1) Incubating at room temperature for 5 minutes before centrifugation can increase yield.2) Use an additional 50-100 µ Further elution with L buffer or sterilized water can increase yield.3) If you want to increase the final concentration of DNA, you can add the DNA eluent obtained in step 13 back onto the adsorption membrane and repeat step 13, but it may reduce the total yield.4) The elution buffer does not contain chelating agents, please store DNA at -20 ℃.5) The residual trace PCR inhibitors in the genomic DNA template may have adverse effects on the PCR reaction, which can usually be resolved by diluting the DNA by 2-10 times.Appendix: Grind the sample using one of the following methods1. Manually vortex oscillate at maximum speed on the vortex oscillator for 10 minutes.2. On a vortex oscillator equipped with a 1.5-2 mL horizontal centrifuge tube holder, oscillate at maximum speed for 10 minutes (keeping the Lysis Tube horizontal). If the sample size exceeds 12, extend by 5-10 minutes. For example, using Scientific Industries or Mobile's Vortex Genie2 vortex oscillator.3.When using Qiagen's TissueLyser II, grind at 25Hz for 10 minutes.4.When using Qiagen's PowerLyzer 24 Homogenizer, homogenize at 2000 rpm for 30 seconds, pause for 30 seconds, and then homogenize again at 2000 rpm for 30 seconds.5.When using FastPrep-24 from MP Biomedicals, the recommended speed is 6.0 and the time is 40 seconds... Read More | Inquire |