| Description | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Product content: G665990Component200 TStorageG665990ABuffer PG100 mLRTG665990BBuffer PS60 mLRTG665990CBuffer PW (concentrate)50 mLRTG665990DBuffer EB30 mLRTG665990ESpin Columns DM with Collection Tubes200 EART Product Introduction:This kit uses a new silicon-based plasma membrane technology and Product content: G665990Component200 TStorageG665990ABuffer PG100 mLRTG665990BBuffer PS60 mLRTG665990CBuffer PW (concentrate)50 mLRTG665990DBuffer EB30 mLRTG665990ESpin Columns DM with Collection Tubes200 EART Product Introduction:This kit uses a new silicon-based plasma membrane technology and reagent formulation. Through the unique centrifugal adsorption column and the DNA washing elution step, 100 bp-10 kb DNA fragments can be recovered and purified from ordinary or low melting point agarose gel. The sol speed is fast and the recovery rate is high. The sol solution contains a pH indicator, which can be used to determine whether the sol recovery has reached the optimal state based on its color. Each adsorption column can adsorb up to 10 µ G DNA, while effectively removing impurities such as primers, enzymes, mineral oil, and agarose. The purified and recovered DNA has high purity and concentration, good integrity, and can be directly used for molecular biology experiments such as sequencing, linking and transformation, labeling, and in vitro transcription.Self prepared reagents: anhydrous ethanol, isopropanol.Preparation and important precautions before the experiment:1.Before the first use, anhydrous ethanol should be added to the Buffer PW according to the instructions on the reagent bottle label.2. Before use, please check the Buffer PG. If crystallization or precipitation occurs, it can be left in a 37 ℃ water bath for 3-5 minutes to restore clarity.3. It is best to use a new electrophoresis buffer during electrophoresis to avoid affecting the electrophoresis and recovery efficiency; The following experiment requires high requirements, please use TAE electrophoresis buffer as much as possible.4.When cutting glue, the UV irradiation time should be as short as possible to avoid damage to DNA.5. The recovery rate is related to the initial amount of DNA and the elution volume. The smaller the initial amount, the smaller the elution volume, and the lower the recovery rate.6. Preheat the water bath to 50 ℃.7. Buffer PG contains a pH indicator. When the pH is ≤ 7.5, the color of the solution is yellow, and DNA can effectively bind to the membrane. When the pH is too high, the color of the solution turns orange red and purple, which needs to be adjusted.8. All centrifugation steps can be performed at room temperature.Operation steps:1. Cut the single purpose DNA strip from the agarose gel (try to cut the excess), put it into a clean centrifuge tube (self prepared), and weigh and calculate the weight of the gel (record the weight of the centrifuge tube in advance).Attention: If the volume of the adhesive block is too large, it can be cut into small pieces.2. Add one time of the volume of Buffer PG (if the gel weighs 100 mg, its volume can be regarded as 100 µ l. And so on.3.50 ℃ water bath and gently invert the centrifuge tube every 2-3 minutes until the sol turns yellow to ensure full dissolution of the gel block. If there are still unsolved glue blocks, you can add some more sol solution or continue to let it stand for a few minutes until the glue blocks are completely dissolved.Note: 1) After the gel is completely dissolved, the gel solution is yellow, and subsequent operations can be carried out; If the glue solution is orange red or purple, 10-30 can be added to the glue solution µ 3 M sodium acetate (pH 5.0), adjust the color of the solution to yellow before proceeding with subsequent operations.2) After the gel block is completely dissolved, it is best to lower the temperature of the gel solution to room temperature before loading the column. The adsorption column has a weaker ability to bind DNA at higher temperatures.4. (Optional step) When the recovered fragment is less than 300 bp, add 1/2 of the gel volume of isopropanol, and mix it upside down (if the gel weighs 100 mg, add 50 µ Isopropanol of L.5. Column balance: Add 200 to the spin columns DM that have been loaded into the collection tube µ Centrifuge at 13000 rpm (~16200 × g) for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add the solution obtained from steps 3 or 4 to the adsorption column that has been loaded into the collection tube, let it stand at room temperature for 2 minutes, centrifuge at 13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube.Attention: The volume of the adsorption column is 750 µ l. If the sample volume is greater than 750 µ L can be added in batches.7. Add 450 to the adsorption column µ LBuffer PW (please check if anhydrous ethanol has been added before use), centrifuge at 13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube.Note: If purified DNA is used for salt sensitive experiments (such as flat end ligation or direct sequencing), it is recommended to add Buffer PW and let it stand for 2-5 minutes before centrifugation.8. Repeat step 7.9.13000 rpm for 1 minute and discard the waste liquid from the collection tube.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column into a new 1.5 ml centrifuge tube (provided by oneself), and add 50 drops to the middle position of the adsorption membrane in the air µ L Buffer EB, leave at room temperature for 2 minutes. Centrifuge at 13000 rpm for 1 minute and collect DNA solution- Store DNA at 20 ℃.Attention:1) To improve the recovery of DNA, the solution obtained by centrifugation can be re dropped onto the adsorption column, left at room temperature for 2 minutes, and centrifuged at 13000 rpm for 1 minute.2) The elution volume should not be less than 30 µ l. A small volume will affect the recovery efficiency.3) When recovering DNA fragments larger than 10 kb, Buffer EB should be preheated in a 50 ℃ water bath to increase recovery efficiency.Note: This reagent kit is also suitable for the purification and recovery of PCR products. Add an equal volume of Buffer PG to the PCR reaction solution and mix thoroughly (for small fragments with a recovery of less than 150bp, the solution volume can be increased to three times to improve the recovery rate). Follow step 5 above for further operations... Read More | Store at -20°C. Please refer to protocols | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product contentY666144Component50 TStorageY666144ABuffer P115 mLRTY666144BBuffer P215 mLRTY666144CBuffer N320 mLRTY666144DBuffer PS15 mLRTY666144EBuffer PB10 mLRTY666144FBuffer PW (concentrate)10 mLRTY666144GBuffer EB10 mLRTY666144HGlass Beads2 gRTY666144IRNase A (10mg/mL)150 µLRTY666144JSpin Product contentY666144Component50 TStorageY666144ABuffer P115 mLRTY666144BBuffer P215 mLRTY666144CBuffer N320 mLRTY666144DBuffer PS15 mLRTY666144EBuffer PB10 mLRTY666144FBuffer PW (concentrate)10 mLRTY666144GBuffer EB10 mLRTY666144HGlass Beads2 gRTY666144IRNase A (10mg/mL)150 µLRTY666144JSpin Columns DM with Collection Tubes50 setsRTProductsThis kit is improved on the basis of common alkaline lysis method, the glass beads can effectively break the yeast cell wall, the new silica matrix membrane and buffer system can efficiently and specifically bind the plasmid DNA, and at the same time can maximize the removal of proteins and other impurities, the whole process is convenient and fast, no need to use toxic and harmful reagents, and can be processed at the same time for multiple samples. In addition to yeast cells, it can also be used in E. coli. Plasmid DNA extracted with this kit can be used in various molecular biology experiments, such as ligation, transformation, sequencing and library screening.Self-contained reagents: β-mercaptoethanol, anhydrous ethanol.Pre-experiment Preparation and Important Notes1. All components can be stably stored in dry, room temperature (15-30℃) environment for 1 year, the adsorption column can be stored at 2-8℃ for a longer period of time, and Buffer P1 with RNase A can be stably stored at 2-8℃ for 6 months.2. Before the first use, add all the RNase A solution to Buffer P1, mix well, and store at 2-8℃.3. Anhydrous ethanol should be added to Buffer PW before first use according to the instructions on the reagent bottle label.4. Before use, please check whether Buffer P2 and Buffer N3 are crystallized or precipitated. If there is any crystallization or precipitation phenomenon, it can be clarified by taking a water bath at 37℃ for a few minutes to restore the clarity.5. Be careful not to touch Buffer P2 and Buffer N3 directly, and tighten the lid immediately after use.6. The amount of plasmid extracted is related to the yeast strain, plasmid copy number, culture conditions, etc. Usually, yeast plasmid copy number is very low, which is difficult to be detected by electrophoresis or spectrophotometer method.Procedure1. Take 1-5 ml of yeast culture (maximum 5×107 yeast cells, generally for Saccharomyces cerevisiae OD = 1.0, equivalent to 1-2×107 cells/ml) and add it to a centrifuge tube (self-provided), centrifuge for 30 seconds at 12,000 rpm (~13,400×g), collect the bacterial precipitate, and aspirate as much as possible to discard the supernatant.2. Add 250µl Buffer P1 to the bacterium (please check if RNase A has been added first) and resuspend the precipitate.3. Add 40mg of Glass Beads to the above mixture and vortex and shake for 10 minutes.4. Add 250 µl of Buffer P2 to the centrifuge tube, mix gently by turning up and down 6-8 times, and let stand at room temperature for 5-10 minutes, at which time the bacterial solution should become clear and viscous.Note: Mix gently, do not shake violently, so as not to interrupt the genomic DNA, resulting in genomic DNA fragments mixed in the extracted plasmid. If the solution does not become clear, it suggests that the amount of bacteria may be too large and the lysis is not complete, and the amount of bacteria should be reduced.5. Add 350 µl of Buffer N3 to the centrifuge tube and immediately mix gently up and down 6-8 times, at which point a white flocculent precipitate appears, and centrifuge at 12,000 rpm for 20 minutes.Note: Buffer N3 should be mixed immediately after addition to avoid localized precipitation.6. Column Equilibration: Add 200 µl of Buffer PS to the Spin Columns DM in the collection tube, centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid from the collection tube, and place the column back into the collection tube.7. Add the supernatant from step 5 to the adsorbent column that has been loaded into the collection tube, taking care not to aspirate the precipitate.Note: The maximum volume of the adsorption column is 750 µl, and the solution is passed through the column in 2 times.8. Centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube and place the adsorption column back into the collection tube.9. Add 150 µl Buffer PB to the adsorbent column, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.10. Add 750 µl Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first), centrifuge at 12,000 rpm for 1 minute, and pour off the waste liquid in the collection tube.11. Place the column back into the recovery collection tube and centrifuge at 12,000 rpm for 2 minutes, pouring off the waste liquid. Leave the column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).12. Place the adsorbent column in a new centrifuge tube, add 50-100 µl of Buffer EB to the center of the adsorbent membrane dropwise, let it stand at room temperature for a few minutes, centrifuge at 13,000 rpm for 1 minute, and collect the plasmid solution into the centrifuge tube. Store the plasmid at -20°C.Attention:1) To increase the recovery efficiency of the plasmid, the resulting solution can be reintroduced into the adsorbent column, left at room temperature for a few minutes, centrifuged at 13,000 rpm for 1 minute, and the plasmid solution collected into a centrifuge tube.2) When the plasmid copy number is low or >10 kb, Buffer EB is preheated at 65-70°C in a water bath, which can increase the extraction efficiency.3) Usually yeast plasmids have very low copy number and are difficult to detect by electrophoresis or spectrophotometry. If the extracted plasmid is to be used in the next step of the experiment, it is usually recommended to use 1-5µl of the plasmid as PCR template, and 5-10µl of the plasmid for transformation of E. coli.4) Commercial high transformation efficiency receptor cells should be used for transformation of E. coli... Read More |