| Description | Inquire | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products content Products IntroductionThis kit is a dedicated sample preparation solution for microbiome analysis and is suitable for the purification and enrichment of genomic DNA of pathogenic microorganisms such as bacteria and fungi from mixed samples such as swabs, blood, sputum, alveolar Products content Products IntroductionThis kit is a dedicated sample preparation solution for microbiome analysis and is suitable for the purification and enrichment of genomic DNA of pathogenic microorganisms such as bacteria and fungi from mixed samples such as swabs, blood, sputum, alveolar lavage, etc. During the purification process, differential lysis of the host cells and subsequent enzymatic digestion can effectively remove most of the host DNA while providing a comprehensive coverage of the bacterial and fungal DNA loci to a higher level. By differential lysis of host cells and subsequent enzymatic digestion, this kit can effectively remove most of the host DNA while maximizing the full coverage of bacterial, fungal and other pathogenic microbial DNA sites, thus obtaining microbiome DNA enrichment products with a higher coverage. Microbial DNA purified with this kit is suitable for a variety of downstream applications, including whole genome sequencing analysis, 16S rDNA-based high sensitivity microbiome analysis, and macrogenomic birdshot sequencing analysis. Self-contained reagents and consumablesSterile pipette tips with aerosol barrier to prevent cross-contamination anhydrous ethanol Microcentrifuge tubes (2 ml/1.5 ml) PBS buffer (required for some samples only)Pre-experiment Preparation and Important Notes1. Add 1.25 ml Proteinase K Storage Buffer to Proteinase K and store at -20℃. Do not leave the prepared Proteinase K (20 mg/ml) at room temperature for a long time, and avoid repeated freezing and thawing to avoid affecting its activity.2. Dissolve Lysozyme (100 mg) in 10 ml Enzymatic Lysis Buffer to a final concentration of 10 mg/ml, dispense into sterile tubes and store at -20℃. Do not leave the prepared Lysozyme (10 mg/ml) at room temperature for a long time and avoid repeated freezing and thawing to avoid affecting its activity.3. Thaw Buffer GB1 and Buffer GB2 at room temperature or 2-8°C before use and mix thoroughly. Thawed Buffer GB1 and Buffer GB2 can be left at 2-8°C for 1-2 weeks without affecting their activity, and should be stored at -20°C for long term storage. To ensure optimal performance, do not freeze or thaw more than three times. If less than one bottle of Buffer GB1 and Buffer GB2 is required for a single extraction, ensure that it is used under sterile conditions such as an ultra-clean bench and avoid microbial contamination and growth in the remaining buffer.4. Before first use, anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the vial label and labeled.5. Check Buffer GL for crystallization or precipitation before use, and if crystallization or precipitation occurs, redissolve Buffer GL in a 56°C water bath.6. If the downstream experiments are sensitive to RNA contamination, 4 µl of DNase-Free RNase A (100 mg/ml) can be added before adding Buffer GL. RNase A is not provided in the kit, but can be ordered separately from CW0601S.7. This kit is designed for the isolation of DNA from intact microbial cells. To ensure optimal recovery of microbial DNA, samples should be fresh. If storage or transportation is required, this should preferably be done at 2-8°C and not frozen or thawed, as freezing and thawing can damage the integrity of the microbial cells and therefore result in the loss of exposed microbial DNA during host DNA removal.8. To avoid false results due to contamination, keep the work area clean, wear protective clothing, and set up controls for quality control. Use appropriate measures to handle sample materials to minimize the risk of cross-contamination. During the extraction process, use DNA-free pipette tips and consumables, and cap reagents immediately after use to prevent contamination. procedure1. Sample pre-treatment: 1a: For swab samples, swirl the swab portion of the swab in 0.5 ml PBS for at least 20 s. Squeeze the swab several times against the wall of the tube before removing it so that as much of the bacterial fluid as possible can be squeezed out of the swab to minimize sample loss. 1b: For viscous samples, e.g. sputum, take ~500 µl of sample, add 1.5 times the volume (~750 µl) of Buffer GB1 and incubate at 37°C, 600 rpm for 15-30 min until the sample is completely liquefied.Note: The sample volume can be increased or decreased appropriately and the amount of Buffer GB1 added adjusted accordingly.1c: For alveolar lavage fluid containing a small amount of viscous sputum, centrifuge as much of the alveolar lavage fluid as possible, carefully remove the supernatant, and retain the lower viscous fraction (containing sputum, cells, and organisms), add 1.5 times the volume of Buffer GB1, and incubate for 15-30 min at 37°C, 600 rpm until the sample is completely liquefied.1d: For non-viscous body fluid samples such as blood and cerebrospinal fluid, liquefaction treatment is not required, and an appropriate amount of sample is taken directly, the operation of step 2 is carried out, and the cell precipitate is collected by centrifugation.2. Centrifuge at 10000 rpm for 5-10 min at room temperature and carefully discard the supernatant.Note: Do not disturb the lower cell sediment to avoid sample loss.3. Add 500 µl Buffer GB2, vortex to mix, and incubate at room temperature, 600 rpm for 10 min. 4. Centrifuge at 12000 rpm for 2 min and carefully remove the supernatant.Note: Do not disturb the bacterial precipitate when removing the supernatant to avoid sample loss.5. Add 200 µl of Buffer GB2 to the precipitate, add 2 µl of Benzonase and incubate for 30 min at 37°C, 600 rpm. 6. Centrifuge at 12000 rpm for 2 min, discard the supernatant, add 500 µl of Buffer GB2, vortex and wash the precipitate. Repeat the procedure once.7. Centrifuge at 12000 rpm for 2 min, discard the supernatant, and finally aspirate the residual Buffer GB2 with a small-volume tip. 8. Add 180 µl Lysozyme (10 mg/ml), resuspend the bacterial precipitate and transfer the bacterial resuspension to a Lysis Tube.9. The Lysis Tube is incubated at 37°C, 600 rpm for 20-30 min, then vortexed for 10 min or processed on a thermostatic homogenizer for 10 min at maximum vibration speed (2500-2900 rpm).10. Centrifuge briefly, add 20 µl proteinase K, vortex to mix, add 200 µl buffer GL, vortex to mix, and incubate for 30 min at 56°C, 600 rpm. Note: 1) Do not add Proteinase K directly to Buffer GL.2）For RNA removal, add 4 µl DNase-Free RNase A (100 mg/ml) before adding Buffer GL, shake to mix, and let stand at room temperature for 5-10 minutes.11. Centrifuge at 12000 rpm for 1 min and carefully aspirate the supernatant into a new centrifuge tube. Note: Do not aspirate the glass beads.12. Add 200 µl of anhydrous ethanol, vortex to mix, and centrifuge momentarily to collect the solution to the bottom of the tube. Note: The addition of anhydrous ethanol may produce a white precipitate that will not affect subsequent experiments.13. Add all of the solution from step 12, including the precipitate, to the Spin Columns DM in the collection tube, or transfer the solution several times if it cannot be added all at once. centrifuge at 12,000 rpm for 1 minute, pour off the waste from the collection tube, and return the column to the collection tube.14. Add 500 µl Buffer GW1 to the adsorbent column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 min, pour off the waste liquid from the collection tube, and put the adsorbent column back into the collection tube.15. Add 500 µl Buffer GW2 to the adsorbent column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube. Note: Step 15 can be repeated once if further improvement of DNA purity is required.16. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the column at room temperature for a few minutes and dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorbent column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).17. Place the adsorbent column in a new centrifuge tube (supplied), add 50 µl of Buffer GE to the center of the adsorbent column overhang, let stand at room temperature for 5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20 °C. Attention:1）If the downstream experiments are sensitive to pH or EDTA, sterilized water can be used for elution. The pH value of the eluent has a great influence on the elution efficiency. If the eluent is made of water, the pH value should be 7.0-8.5 (the pH value of water can be adjusted to this range with NaOH), and the elution efficiency is not high when the pH value is lower than 7.0.2）Incubation at room temperature for 5 minutes prior to centrifugation increases yield.3）If the final concentration of DNA is to be increased, the DNA eluate obtained in step 17 can be re-spiked onto the adsorbent membrane and step 17 repeated. 4）DNA stored in water will be affected by acidic hydrolysis. For long-term storage, it is recommended to elute with Buffer GE and store at -20℃... Read More | S665948 Component 1 mL 5 mL Storage S665948A 2×SYBR qPCR Master Mix 1 mL 5×1 mL -20℃. Avoid freeze/ Thaw cycle. S665948B qPCR Primer Mix 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948C DNA Standard 1 100 µL 5×100 µL -20℃. Avoid S665948 Component 1 mL 5 mL Storage S665948A 2×SYBR qPCR Master Mix 1 mL 5×1 mL -20℃. Avoid freeze/ Thaw cycle. S665948B qPCR Primer Mix 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948C DNA Standard 1 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948D DNA Standard 2 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948E DNA Standard 3 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948F DNA Standard 4 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948G DNA Standard 5 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948H 50×High ROX 40 µL 200 µL -20℃. Avoid freeze/ Thaw cycle.Product IntroductionThis product is used for real-time fluorescence quantitative PCR (qPCR) using the product after NGS library construction by dye method (SYBR Green I). The kit provides the reaction mixture, DNA primer mixture, and standards required for the qPCR process, and the reagent system is complete, easy and convenient to operate. The kit uses a new chemically modified high-efficiency hot-start polymerase, the activation of the enzyme needs to be incubated at 95 ℃ for 10 min. the product is highly specific, high amplification efficiency, and able to quickly and accurately quantify the concentration of the constructed library. It is suitable for fluorescent quantitative PCR instruments that do not require ROX as a calibration dye, such as Roche LightCycler 480, Roche LightCyler 96, Bio-radiCyleriQ, iQ5, CFX96.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument.Instruments that do not require ROX calibration: Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96, etc.Instruments requiring Low ROX calibration: ABI Prism7500/7500 Fast, QuantStudio®3 System, QuantStudio®5 System, QuantStudio®6 Flex System, QuantStudio®7 Flex System, ViiA 7 System, Stratagene Mx3000/Mx3005P, Corbett Rotor Gene 3000, and others.Instruments requiring High ROX calibration: ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, etc.Note: High Rox and Low Rox are formulated as described in Use 2.Scope of applicationThis product is designed for absolute quantification of the concentration of Illumina platform second-generation sequencing libraries. The end of the library contains Illumin P5 and P7 chip binding sequences, the length of which does not exceed 1kb, and the concentration of which is not less than 0.002pM can be used to perform quantitative experiments with this product. The qPCR Primer Mix provided in the kit contains the following two primer sequences:Primer 1:5'-AAT GAT ACG GCG ACC ACC GA-3' Primer 2: 5'-CAA GCA GAA GAC GGC ATA CGA-3'The primer sequence can be used in advance to confirm whether the library can be amplified by that primer pair.UsageAmplification template preparationThe library samples to be detected were diluted with TE (10 mM Tris-Cl, pH 8.0, 1 mM EDTA), and the concentration after dilution was as close as possible to the range of 0.01-20 pM. 4°C on ice was set aside.qPCR reaction system preparationThe desired cryopreservation reagent is pre-melted completely and mixed by inverting several times before preparation, then centrifuged briefly and set aside.The base reaction system for 20 µl was as follows:Reagent20 µl Reaction system2×SYBR qPCR Master Mix10 µlqPCR Primer Mix 10.8 µlTemplate4 µlddH₂O5.2 µlDescription: High Rox model: add 1 µl High Rox per 50 µl of reaction system;Low Rox model: 1 µl High Rox per 500 µl of reaction system.Prepare a sufficient amount of reaction system mixture according to the need, mix well and add to the reaction wells in a volume of 16 µl per well, add the same volume of TE to the blank control, and then add the prepared standards and diluted samples to the corresponding reaction wells in a volume of 4 µl/well. It is recommended to use 20 µl reaction system, if you need to carry out a smaller system reaction, the system components can be reduced in equal proportion.qPCR reaction programThe annealing temperature should be 60-64°C as a reference for the setting range, and the annealing temperature can be increased when a non-specific reaction occurs.If the average length of the library is greater than 700bp, the annealing/extension time should be increased appropriately.data analysisStandard curve productionThe standard curve was plotted using Ct values in the valid range. The standard curve correlation coefficient R2 should not be less than 0.99 and the slope should lie between -3.1 and -3.6. If the standard curve parameters are not reasonable, it is recommended to repeat the experiment.DNA Standard NameDNA Standard ConcentrationDNA Standard 120 pMDNA Standard 22 pMDNA Standard 30.2 pMDNA Standard 40.02 pMDNA Standard 50.002 pMLibrary Concentration CalculationsThe difference in Ct between the three replicate wells of the experiment should be no more than 0.2, otherwise the invalid data should be deleted or the experiment should be repeated. Do not use the Ct outside the valid Ct range of the standard curve to calculate the concentration of the diluted libraries. Please refer to the data processing Excel of this product for the specific library concentration calculation method.matters needing attentionThese instructions should be read in detail before testing. It should be carried out by personnel with specialized experience or qualified by training.Mix gently by turning up and down, avoid foaming as much as possible, and centrifuge for a short time before use.Avoid repeated freezing and thawing of this product; repeated freezing and thawing may degrade product performance.When preparing reaction solutions, use new or non-contaminated tips and centrifuge tubes to prevent contamination as much as possible... Read More |