| Description | Inquire | Description:Acetylcholinesterases (AChEs) are enzymes that hydrolyze the neurotransmitter acetylcholine (ACh) to acetate and choline. AChE is located at the synaptic cleft and functions to terminate synaptic transmission by catalyzing the breakdown of ACh allowing cholinergic neurons to Description:Acetylcholinesterases (AChEs) are enzymes that hydrolyze the neurotransmitter acetylcholine (ACh) to acetate and choline. AChE is located at the synaptic cleft and functions to terminate synaptic transmission by catalyzing the breakdown of ACh allowing cholinergic neurons to return to a resting state after activation. It is also found in membranes of red blood cells, motor and sensory fibers, muscles, nerves and central and peripheral tissues. Changes in AChE activity may result from exposure to certain insecticides, which act as cholinesterase inhibitors. Inhibitors of AChE are also used to treat certain conditions such as dementia.Acetylcholinesterase activity assay kit has been used to determine the activity of acetylcholinesterase in a rat organophosphate model and in brain tissue homogenates.Principle:Acetylcholinesterase can catalyze the hydrolysis of acetylcholine to choline, and the reaction of choline with disulfide p-nitrobenzoic acid to produce 5-merhydryl-nitrobenzoic acid (TNB). The product has a characteristic absorption peak at 412 nm, and the activity of acetylcholinesterase can be characterized by the change of light absorption valueThe Dilution Calculator EquationConcentration (start)xVolume (start)= Concentration (final)× Volume (final)This equation is commonly abbreviated as: C1V1 = C2V2... Read More | Product content: Component G665666 200 preps Buffer P1 60ml Buffer P2 60ml Buffer E3 60ml Buffer PW (concentrate) 25ml Buffer EB 30ml RNase A (10 mg/ml) 600 µl Spin Columns DM 200 with Collection Tubes 200Product Introduction:This reagent kit is suitable for extracting 1-5 ml of Product content: Component G665666 200 preps Buffer P1 60ml Buffer P2 60ml Buffer E3 60ml Buffer PW (concentrate) 25ml Buffer EB 30ml RNase A (10 mg/ml) 600 µl Spin Columns DM 200 with Collection Tubes 200Product Introduction:This reagent kit is suitable for extracting 1-5 ml of bacterial solution. On the basis of alkaline lysis of cells, it efficiently and specifically binds plasmid DNA through a new silicon-based membrane. Each adsorption column can adsorb up to 40% µ The plasmid DNA of g is effectively removed with a special buffer system to effectively remove impurities such as proteins. The yield and purity of plasmids obtained from this kit are high, and the quality is stable. It is suitable for downstream experiments such as cell transfection, DNA sequencing, PCR, PCR based mutations, in vitro transcription, transformed bacteria, and endonuclease digestion.Self prepared reagents: anhydrous ethanol, isopropanol.Preparation and important precautions before the experiment:1. All components can be stably stored for 1 year in a dry, room temperature (15-30 ℃) environment. The adsorption column can be stored for a longer time at 2-8 ℃. 2.Buffer P1 with RNase A added can be stably stored for 6 months at 2-8 ℃. Before use, add RNase A to Buffer P1 (add all RNase A provided in the reagent kit), mix well, and store at 2-8 ℃. Before use, it is necessary to leave it at room temperature for a period of time, and then use it after returning to room temperature.3.Before the first use, anhydrous ethanol should be added to the Buffer PW according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in Buffer P2 and Buffer E3. If there is any crystallization or precipitation, you can take a water bath at 37 ℃ for a few minutes to restore clarity.5. Note that Buffer P2 and Buffer E3 contain irritating substances. Please wear gloves when operating and immediately cover the lid after use.6.The amount and purity of plasmid extraction are related to factors such as bacterial culture concentration, strain type, plasmid size, and plasmid copy number.7. The maximum volume of Spin Columns DM is 750 µ l. If the sample volume is greater than 750 µ L can be added in batches.Operation steps:1. Take 1-5 ml of overnight cultured bacterial solution and add it to a centrifuge tube (provided). Centrifuge at 13000 rpm (~16200 × g) for 1 minute to collect bacteria, and try to discard all the supernatant as much as possible.2. Add 200 to the centrifuge tube containing bacterial sediment µ Buffer P1 (please check if RNase A has been added first), mix thoroughly with a pipette or vortex oscillator, and suspend bacterial precipitation.Attention: If the bacterial blocks are not thoroughly mixed, it will affect the cracking effect, resulting in low extraction amount and purity.3. Add 200 to the centrifuge tube µ Buffer P2, gently invert and mix 8-10 times to fully lyse the bacterial cells. At this point, the solution should become clear and viscous.Attention: Mix gently and do not shake vigorously to avoid interrupting genomic DNA and mixing genomic DNA fragments in the extracted plasmid. If the solution does not become clear, it indicates that the bacterial count may be too large and the lysis may not be complete. The bacterial count should be reduced or the dosage of P1, P2, E3, and isopropanol should be increased proportionally.4. Add 200 to the centrifuge tube µ Buffer E3, immediately invert and mix 8-10 times, at which point white flocculent precipitates appear. Centrifuge at 13000 rpm for 5 minutes.Attention: After adding Buffer E3, it should be mixed evenly immediately to avoid local precipitation.5. Add 260 to the spin columns DM that have been loaded into the collection tube µ After adding isopropanol, immediately add the supernatant collected in step 4 and mix it upside down.Attention: After adding isopropanol, immediately add the supernatant and mix well to avoid isopropanol dripping into the collection tube after being left for a long time. The maximum volume of the adsorption column is 750 µ l. If the sample volume is greater than 750 µ l. Isopropanol and the supernatant can be collected in a centrifuge tube (provided by oneself), mixed well, and passed through the column in batches.6.13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 400 to the adsorption column µ L Buffer PW (please check if anhydrous ethanol has been added first), centrifuge at 13000 rpm for 1 minute, and discard the waste liquid in the collection tube.8. Place the adsorption column in a new collection tube and add 50-100 to the middle of the adsorption membrane µ Centrifuge at 13000 rpm for 1 minute using buffer EB and collect the plasmid solution into a centrifuge tube- Store the plasmid at 20 ℃.Note: 1) To increase the efficiency of plasmid recovery, the obtained solution can be added back to the adsorption column, left at room temperature for 2-5 minutes, centrifuged at 13000 rpm for 2 minutes, and collected into a centrifuge tube.2) When the plasmid copy number is low or>10 kb, preheating the buffer EB in a water bath at 65-70 ℃ can increase the extraction efficiency... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export |