| Description | Inquire | Inquire | Product content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct IntroductionProduct content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct Introduction:This product is a specialized reagent kit for one-step Real Time RTqPCR using probe methods (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT qPCR reaction, reverse transcription and quantitative PCR are requiredConducted in the same reaction system, there is no need to add reagents or open the tube cap during the reaction process, avoiding contaminationThis has improved the efficiency of the experiment. This product has high detection sensitivity, strong fluorescence signal, and high signal-to-noise ratio, making it very suitable forDetection of RNA viruses and other trace amounts of RNA. The special buffering system it contains can enable reverse transcriptase to interact with DNA polymeraseMaximize the effectiveness and improve reaction efficiency. By using this product, a wider linear range can be obtained, which is beneficial for the target base Due to more accurate quantification, good repeatability, and high reliability.ROX dye is used to correct the fluorescence signal error generated between wells in quantitative PCR instruments, and is generally used for ABIReal Time PCR amplification equipment from companies such as Stratagene. The excitation optical systems of different instruments vary, thereforeThe concentration of ROX dye must be matched with the corresponding fluorescence quantitative PCR instrument.matters needing attention:1. Before using the reagents in this reagent kit, please gently mix them upside down to avoid foaming as much as possible, and use them after brief centrifugation. 2. This product uses RNA as a template for one-step RT-PCR experiments, and RNase contamination should be avoided during the operation process,2.It is recommended to perform RNA operations in a dedicated area, using specialized instruments and consumables. Operators should wear masks and disposable gloves and frequently change gloves. Experimental consumables should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours and sterilized under high pressure for 30 minutes before use.3. Each reagent in this kit should avoid repeated freezing and thawing as much as possible, as repeated freezing and thawing may lead to a decrease in product performance.4. This reagent kit must use specific primers, and the selection of primers can be based on specific experiments. The quality of primer design directly affects the results of RT qPCR reaction. When designing primers, GC content, primer length, and primer should be considered Due to factors such as location, secondary structure of PCR products, it is recommended to use professional primer design software for design.5. It is recommended to use specific probes in this reagent kit and use professional design software for design. Usage: The following examples are typical reaction systems and conditions. In practical operation, corresponding improvements and optimizations should be made based on the differences in template, primer structure, and target fragment size. (Please prepare the reaction solution on ice)1. Dissolve the RNA template, primers, 2xGoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix, and RNase Free Water and place them on ice for later use.2. PCR reaction system: reagent 25 µl Reaction system final concentration 2×GoldStar Probe One Step Buffer 12.5 µl 1× Forward Primer,10 µM 0.5 µl 0.2 µM 1) Reverse Primer,10 µM 0.5 µl 0.2 µM 1) Probe ,10 µM 0.5 µl 0.2 µM 2) GoldStar Probe One Step EnzymeMix 1.0 µl / RNA Template X µl 10 pg – 100 ng3) 50×Low ROX or High ROX (optional)4) 0.5 µl 1× RNase-Free Water up to 25 µl /Note: 1) Typically, the primer concentration is 0.2 µ M can achieve good results, ranging from 0.1 to 1.0 µ M serves as a reference for setting the range. 2) The concentration of the probe used is related to the fluorescent quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance. Please refer to the instrument manual or the specific usage requirements of each fluorescent probe for concentration adjustment during actual use.3) The amount of RNA templates is usually based on 10 pg-100 ng as a reference. Due to the different copy numbers of target genes contained in templates of different species, gradient dilution can be applied to the templates to determine the optimal template usage.4) The excitation optical systems of different instruments vary, and depending on the instrument used for fluorescence quantification, 50 x Low ROX or 50 x High ROX can be added.3. Mix well, centrifuge briefly, and collect the solution to the bottom of the tube.4. RT-PCR reaction conditions steps temperature time / Reverse Transcription 45℃ 10 min / PCR pre denaturation 95℃ 10 min / denaturation 95℃ 15s 30-40cycle Annealing/Extension 60℃ 45s 30-40cycleAttention:1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 5-10 minutes.2) It is recommended to use a two-step PCR reaction program. If good experimental results cannot be obtained due to the use of primers with lower Tm values, a three-step PCR amplification can be attempted. The annealing temperature should be set within the range of 56 ℃ -64 ℃ as a reference... Read More | Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801DRNase-Free Water1.5 mL-20℃. Avoid freeze/ Thaw cycle. Product Introduction This product is a specialized kit for one-step Real-Time RT-qPCR using the probe method (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT-qPCR reaction, reverse transcription and quantitative PCR are carried out in the same reaction system, and there is no need to add reagents or open the cap of the tube during the reaction process, which avoids contamination and improves the experimental efficiency at the same time. With high detection sensitivity, strong fluorescence signal and high signal-to-noise ratio, this product is very suitable for the detection of RNA viruses and other trace RNA. The special buffer system contained in this product can maximize the effectiveness of reverse transcriptase and DNA polymerase at the same time and improve the efficiency of the reaction. A wider linear range can be obtained with this product, more accurate quantification of the target gene, good reproducibility and high confidence.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument. Instruments that do not require ROX calibration (G665836) Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96 and others. Instruments that require High ROX calibration (G665801) ABI Prism 7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, and others.matters needing attention1.Before using the reagents in this kit, please mix them gently by turning them up and down to avoid foaming as much as possible, and use them after brief centrifugation.2.This product uses RNA as the template for one-step RT-PCR experiment, RNase contamination should be avoided during operation, it is recommended to operate RNA in a special area, use special instruments and consumables, the operator with a mask and disposable gloves and often change the gloves, the experiment-related consumables should be processed with 0.1% DEPC (diethyl ether pyrocarbonate) aqueous solution for 12 hours at 37℃, and autoclaved for 30 minutes before use. The consumables should be treated with 0.1% DEPC (diethylpyrocarbonate) aqueous solution at 37℃ for 12 hours and autoclaved for 30 minutes.3.Repeated freezing and thawing of each reagent in this kit should be avoided as much as possible; repeated freezing and thawing may degrade the product performance.4.This kit must use specific primers, the choice of primers can be selected according to specific experiments, the good or bad primer design directly affects the results of RT-qPCR reaction, the design of primers need to consider the GC content, primer length, primer position, the secondary structure of the PCR product and other factors, it is recommended to use a professional primer design software for design.5.This kit is recommended to use specific probes, and it is recommended to use professional design software for designing.UsageThe following examples are conventional reaction systems and conditions, which should be improved and optimized according to the different templates, primer structures and target fragment sizes in actual operation. (Please prepare the reaction solution on ice.)1. Dissolve RNA template, primers, 2× GoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix and RNase-Free Water and set aside on ice.2. PCR reaction system:reagents25µl reaction systemfinal concentration2×GoldStar Probe One Step Buffer12.5µl1×Forward Primer, 10µM0.5µl0.2µM¹⁾Reverse Primer, 10µM0.5µl0.2µM¹⁾Probe, 10µM0.5µl0.2µM²⁾GoldStar Probe One Step EnzymeMix1.0µl RNA TemplateXµl10pg-100ng³⁾50 x Low ROX or High ROX (optional)⁴⁾0.5µl1×RNase-Free WaterUp to 25µlNote: 1) Usually, better results can be obtained with a primer concentration of 0.2 µM, and 0.1-1.0 µM can be used as a reference for setting the range.(2) The concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, please refer to the instrument manual or the specific requirements for the use of each fluorescent probe for the adjustment of the concentration in actual use.(3) Usually the amount of RNA template is 10pg-100ng as a reference. Since the templates of different species contain different copy numbers of target genes, the templates can be diluted in gradient to determine the optimal amount of template to use.(4) The excitation optical system varies from instrument to instrument, choose to add 50×Low ROX or 50×High ROX according to the instrument using fluorescence quantification.3. Mix well, centrifuge briefly, and collect the solution at the bottom of the tube.4.RT-PCR reaction conditions:Note: 1) The hot start enzyme used in this product must be activated under the condition of pre-denaturation 95℃, 5-10min. 2) It is recommended to use the two-step PCR reaction program, if you can not get good experimental results due to the use of primers with lower Tm value, etc., you can try to carry out the three-step PCR amplification, and the annealing temperature should be set in the range of 56℃-64℃ as a reference... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |