| Description | Inquire | Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) uses RedNucleus I staining to detect cell cycle. RedNucleus I is a far-infrared nucleic acid dye with cell membrane permeability, which can quickly enter living cells, specifically bind to DNA, and perform cell cycle detection on living cells without RNase digestion. Compared with the traditional PI staining method, the cells do not need to be broken or fixed, and the operation is simpler. RedNucleus I is a fluorescent dye of double-stranded DNA, and the fluorescence intensity after binding to double-stranded DNA is proportional to the content of double-stranded DNA. The intracellular DNA content can be measured by flow cytometry, and then the cell cycle analysis can be carried out according to the distribution of DNA content. After RedNucleus I staining, assuming that the fluorescence intensity of G0 / G1 phase cells is 1, the theoretical value of the fluorescence intensity of G2 / M phase cells containing two copies of genomic DNA is 2, and the fluorescence intensity of S phase cells undergoing DNA replication is between 1-2. In addition, RedNucleus I is compatible with dyes such as Horizon BV / BUV, FITC and R-PE, and can be periodically detected after sample staining.The kit is usually used to detect the cell cycle of cultured adherent or suspended cells. If it is used for cell cycle detection of tissues, the tissues must be digested into a single cell state.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. this product is applicable to the detection of living cells and fixed cell cycle with certain limitations. Whether it is applicable to different types of cells needs to be determined after testing. If fixation is needed, it is recommended to use ice bath pre cooling 75-80% ethanol -20 ℃ to fix cells overnight. 3. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 4. for your safety and health, please wear experimental clothes and disposable gloves.Instruction： Experimental materials ( self-provided )：①cell lines or other cell samples ( self-prepared ) ；②This kit ; ③ trypsin ( self-prepared ) ;④ Cell culture medium containing FBS ( self-prepared ) ; Experimental procedure： 1.Preparation of cell samples : ( 1 ) ( This step is for adherent cells, if suspended cells, can be carried out directly step ( 2 ) ) Digest cells with trypsin, add cell culture medium, gently blow away cells, collected into the centrifuge tube. Note : The number of cells on the machine needs to reach 50,000 and above, so the initial number of cells collected needs to be sufficient. ( 2 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. Carefully remove the supernatant, add about 1 mL of ice bath pre-cooled 1 × staining buffer ( 10 × staining buffer diluted with diH2O at 1 : 10 ), re-suspend the cells. Repeat once. ( 3 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. After the supernatant was discarded, 1 mL of culture medium was added to re-suspend the cells ( for fixed cells, 1 × PBS can also be used to re-suspend ). Gently flick the bottom of the centrifuge tube to properly disperse the cells to avoid cell aggregation. 2.Staining : 4 µL of RedNucleus I staining solution was added to each tube of cell samples, slowly and fully mixed, and incubated at room temperature in dark for 20 min ( or incubated at 37 ° C in dark for 5-10 min ). The optimal incubation time of different cells is different, and the staining time can be adjusted and optimized according to the actual staining effect to obtain a more ideal staining effect. 3.Flow cytometry detection and analysis : Excited at 638 nm by flow cytometry, it is recommended to detect in RL3 or FL4 channels, or use RL1 and RL2 channels. Cell DNA content analysis and light scattering analysis were performed using appropriate analysis software.Scope of application：Cell cycle detection... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This kit combines efficient guanidine isothiocyanate lysis technology with silicon matrix membrane purification technology to efficiently extract total RNA from animal cells and tissues. The starting sample usually has a maximum of 30 mg of tissue or 1 x 107 cells. This reagent kit can also recover This kit combines efficient guanidine isothiocyanate lysis technology with silicon matrix membrane purification technology to efficiently extract total RNA from animal cells and tissues. The starting sample usually has a maximum of 30 mg of tissue or 1 x 107 cells. This reagent kit can also recover partially purified RNA, RNA obtained from in vitro transcription and enzymatic reactions. This reagent kit can extract and purify high-quality RNA with a molecular weight greater than 200 bases, with almost no DNA residue. If RNA experiments are to be conducted that are highly sensitive to trace amounts of DNA, residual DNA can be digested and removed on a column using DNase I without RNase. The extracted RNA can be used for downstream experiments such as RT-PCR, Northern Blot, Dot Blot, etc. R666020Component50 TStorageR666020ABuffer RL35 mLRTR666020BBuffer RW140 mLRTR666020CBuffer RW2 (concentrate)11 mLRTR666020DRNase-Free Water10 mLRTR666020ESpin Columns RM with Collection Tubes50 setsRTR666020FRNase-Free Centrifuge Tubes (1.5 mL)50 EART Self prepared reagents: β- Mercaptoethanol, anhydrous ethanol (newly opened or dedicated for RNA extraction).Preparation and important precautions before the experimentTo prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The extracted samples should avoid repeated freeze-thaw cycles, otherwise it will affect the quantity and quality of RNA extraction.3. Before use, please check if there is any crystallization or precipitation in the Buffer RL. It can be heated at 56 ℃ and re solved. Please add Buffer RL before use β- Mercaptoethanol, with a final concentration of 1%. Add 10 to 1ml Buffer RL µ L β- Mercaptoethanol. join β- The buffer RL room temperature of mercaptoethanol can be stored for one month.4. Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.6. If downstream experiments are highly sensitive to DNA, it is recommended to treat RNA with DNase I that does not contain RNase.Operation steps1. Sample processing1a organization: Grind the organization in liquid nitrogen. Add 600 to every 20-30 mg of tissue µ L Buffer RL (check if it is added before use) β- Mercaptoethanol), tissue sample less than 20 mg plus 350 µ Buffer RL. The sample volume shall not exceed one tenth of the buffer RL volume.1b Single layer culture of cells: The cells are directly lysed or processed into cell suspensions in a culture bottle, centrifuged to obtain cell precipitates, and the supernatant is discarded. 600 is added every 6-10 cm2 of culture area µ Buffer RL, less than 6 cm2, add 350 µ Blow buffer RL several times to fully crack it.1c cell suspension: Centrifuge at 12000 rpm (~13400 × g) for 1 minute to discard the supernatant and obtain cell precipitate. Add 600 cells every 5 × 106-1 × 107 cells µ Buffer RL, less than 5 × 106 cells added to 350 µ Blow buffer RL several times to fully crack it.Attention:1) Try to eliminate the cell culture medium as much as possible, as it may inhibit cell lysis and affect RNA production.2) Try to fully suspend and lyse the cells, otherwise it will affect RNA production.2. After the sample is fully lysed, it should be left at room temperature for 5 minutes to completely separate the protein nucleic acid complex.3. Centrifuge at 2000rpm for 2-5 minutes, take the supernatant and proceed to the next step.4. Add 1 volume (600) µ L or 350 µ l) Mix 70% ethanol (prepared without RNase water) well.Attention: Adding ethanol may cause precipitation and will not affect subsequent experiments.5. Add all the solution obtained in step 4 to the Spin Columns RM that has been loaded into the collection tube. If it is not possible to add all the solution to the adsorption column at once, please transfer it in two batches, centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube. Attention: The maximum loading capacity of the adsorption column is 100 µ g, do not overload, otherwise it will affect the yield and purity of RNA.6. Add 700 to the adsorption column µ Centrifuge at 12000 rpm for 1 minute, discard the waste liquid from the collection tube, and place the adsorption column in the collection tube.Optional steps: If conducting RNA experiments that are highly sensitive to trace amounts of DNA, replace step 6 with the following steps.1) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.2) Preparation of DNase I mixture: Take 52 µ Add 8 RNase Free Water to it µ 10 x Reaction Buffer and 20 µ DNase I (1 U/ µ l) Mix well and prepare to a final volume of 80 µ The reaction solution of L.Attention: The above system is configured according to our company's DNase I reaction system. Please refer to the corresponding manual for other company products.3) Add 80 µ l of the prepared DNase I reaction solution directly to the adsorption column and incubate at 20-30 ℃ for 15 minutes.4) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.7. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column in the collection tube.8. Repeat step 7. 9. Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column in a new RNase free centrifuge tube, and add 30-50 to the middle of the adsorption column in the air µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 10 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 10... Read More |