| Description | Hydrogen peroxide (H₂O₂) is the most common reactive oxygen species (ROS) in living organisms. It is a by-product of active oxygen metabolism, primarily produced by enzymes like SOD and XOD, and degraded by enzymes such as CAT and POD. H₂O₂ is not only a significant ROS but Hydrogen peroxide (H₂O₂) is the most common reactive oxygen species (ROS) in living organisms. It is a by-product of active oxygen metabolism, primarily produced by enzymes like SOD and XOD, and degraded by enzymes such as CAT and POD. H₂O₂ is not only a significant ROS but also a hub for the interconversion of reactive oxygen species. On one hand, H₂O₂ can directly or indirectly oxidize biological macromolecules like nucleic acids and proteins within cells, damaging cell membranes and thereby accelerating cellular aging and disintegration. On the other hand, H₂O₂ is also a key regulatory factor in many oxidative stress responses. It can activate factors like NF-κB, and these H₂O₂-related signaling pathways are associated with many diseases such as asthma, inflammatory arthritis, arteriosclerosis, and neurodegenerative diseases. H₂O₂ is also closely related to processes like cell apoptosis and proliferation.Detection Principle: H₂O₂ oxidizes ferrous ions (Fe²⁺) to ferric ions (Fe³⁺). The Fe³⁺ then forms a purple complex with xylenol orange in a specific solution. The absorbance at 580 nm is directly proportional to the H₂O₂ concentration, allowing for the quantification of H₂O₂ levels.Detection Range: 1-100 µMSensitivity: 1 µMApplicable Samples: Animal/plant tissues, cells, bacteria, serum (plasma), urine.H1492752Component96T480TStorageH1492752AReaction Buffer5 mL25 mL-20℃. Store in the dark.H1492752BH₂O₂ Standard (1M)0.1 mL0.1 mL-20℃. Store in the dark.H1492752CAssay Buffer (10×)13 mL65 mL2-8℃Please check the quantity of each component before the experiment.An additional 10% of each component is provided beyond the specified volume for standard curve preparation or preliminary experiments.User-Provided Instruments and ReagentsTypeNameNotesInstrumentMicroplate ReaderCapable of measuring absorbance at 580 nm.Consumables96-well Microplate / Ultrafiltration tubesStandard transparent plate / 10 kDa MWCOReagentsPBS (pH 7.4) / Deionized Water / 30% ZnSO₄ solutionFor washing cells/bacteria / Reagent preparation / Protein removalOthersHomogenizer (for tissue samples), incubator, ice bucket, low-temperature centrifuge, adjustable pipettes and tipsUsing a multichannel pipette for large-scale detection can improve efficiency.Experimental Procedure1. Reagent PreparationReagent NameReagent PreparationPrecautionsReaction BufferReady-to-use; equilibrate to room temperature before use.Protect from light during the experiment; aliquot and store at -20°C in the dark.H₂O₂ Standard (1M)Ready-to-use; equilibrate to room temperature before use.Protect from light during the experiment; aliquot and store at -20°C in the dark.Assay Buffer (1×)Dilute the 10× Assay Buffer 1:10 with deionized water before use; equilibrate to room temperature.The diluted buffer can be stored at 4°C for at least 2 months. Used for diluting H₂O₂ standard and samples.2. Standard PreparationStandard Curve Setup:First, prepare a 2 mM H₂O₂ Standard: Dilute 2 µL of the 1M H₂O₂ Standard with 998 µL of Assay Buffer (1×).Then, prepare a 100 µM H₂O₂ Standard: Dilute 50 µL of the 2 mM H₂O₂ Standard with 950 µL of Assay Buffer (1×).Using the 100 µM H₂O₂ Standard, prepare further dilutions as shown in the table below.Prepare fresh standard solutions for each experiment.Prepared standards must be used within 4 hours.If the sample is a cell suspension, it is recommended to prepare the H₂O₂ standards using the culture medium.Standard Working Solution100µM Standard (µL)Assay Buffer (1×) (µL)Concentration (µM)1200010021001005034016020420180105101905641962721981Blank020003. Sample PreparationNote: Fresh samples are recommended. If not used immediately, samples can be stored at -80°C for up to 1 month. When ready for the experiment, thaw samples on ice. Note that this may affect sample stability, and results might be lower than expected. The following substances interfere with detection and should be avoided in samples: Ferric salts, iron salts, sucrose, glucose, ascorbic acid, SDS (>0.2%), sodium azide.3.1 Animal Tissues:Wash the tissue with cold PBS to remove as much blood as possible. Blot dry, weigh 0.1 g, and add 1 mL of pre-cooled Assay Buffer (1×). Homogenize the sample on ice. Centrifuge at 10000 g, 4°C for 5 min. Collect the supernatant and keep on ice for detection.3.2 Plant Tissues:Weigh approximately 0.1 g of sample, add 1 mL of pre-cooled Assay Buffer (1×), and grind. Disrupt by ultrasound on ice (power 20% or 200 W, ultrasonicate for 3 s, interval 7 s, repeat 30 times). Centrifuge at 10000 g, 4°C for 5 min. Collect the supernatant and keep on ice for detection.3.3 Cells/Bacteria:Collect 5×10⁶ cells or bacteria. Wash with cold PBS, then add 1 mL of pre-cooled Assay Buffer (1×). Homogenize on ice or disrupt by ultrasound on ice (power 20% or 200 W, ultrasonicate for 3 s, interval 7 s, repeat 30 times). Centrifuge at 10000 g, 4°C for 5 min. Collect the supernatant and keep on ice for detection.3.4 Plasma, Serum, and Urine (and other biological fluids):Remove proteins and use the supernatant. Protein removal methods:Use a 10 kDa ultrafiltration tube: filter and collect the filtrate.Mix sample : 30% ZnSO₄ solution = 20 : 1, vortex, then centrifuge at 10000 g, room temperature for 5 min, and collect the supernatant.4. Assay Steps4.1 Microplate Reader Preparation: Preheat for at least 30 minutes, set wavelength to 580 nm.4.2 Assay System Setup:ReagentStandard Well (µL)Test Well (µL)Standard (various conc.)600Sample060Reaction Buffer40404.3 Mix the reaction system thoroughly and incubate at 37°C for 10 minutes.4.4 Absorbance Measurement: Read the absorbance at 580 nm, recorded as A blank, A standard, and A test. 5. Result CalculationThe following provides both the derived formula and the simplified calculation formula, which are completely equivalent.5.1 Data ProcessingCalculate ΔA standard = A standard - A blank, ΔA test = A test - A blank. 5.2 Standard Curve PlottingPlot the standard curve with standard concentration as the y-axis and ΔA <sub> standard </sub> as the x-axis. Substitute ΔA <sub> test </sub> into the equation to obtain the y value (µM).5.3 Sample H₂O₂ Concentration Calculation(1) Based on sample mass:H₂O₂ Content (nmol/g fresh weight) = y × V sample ÷ (W × V sample ÷ V total ) × n = y ÷ W × n(2) Based on cell or bacterial count:H₂O₂ Content (nmol/10⁴ cells) = y × V sample ÷ (500 × V sample ÷ V total ) × n = y ÷ 500 × n(3) Based on liquid volume:H₂O₂ Content (nmol/mL) = y × V sample ÷ V sample × n = y × nParameter Description:1 µM = 1 nmol/mL;V sample : Volume of sample added;V total : Volume of Assay Buffer (1×) added, 1 mL;n: Sample dilution factor;W: Sample mass, g;500: Cell or bacterial count, in units of 10⁴.6. Result PresentationTypical Standard Curve: y = 207.21x + 1.4921, R² = 0.9988Example-1: 0.1 g of corn tissue was processed and assayed according to the procedure using a 96-well plate.Measured: ΔA test = A test - A blank = 0.278 - 0.048 = 0.230Substituting into the standard curve gives y = 49.15 µM.Calculated based on sample mass:H₂O₂ Content (nmol/g) = y ÷ W × n = 491.5 nmol/g.Precautions1. It is recommended to perform preliminary experiments using 2-3 samples expected to have significant differences before formal testing.2. This kit is compatible with spectrophotometer detection. Adjust the preparation volume of detection reagents proportionally according to the spectrophotometer's requirements.3. It is recommended to establish your own standard curve for improved accuracy. If not, you may refer to the typical standard curve formula provided in the results section for calculation.4. Biochemical reagents are generally irritating and biologically toxic. For your safety and health, please wear appropriate personal protective equipment (lab coat, mask, gloves, hair cap, etc.) throughout the experiment and perform experiments in a fume hood or biosafety cabinet.5. This product is for scientific research use only. Not intended for clinical diagnosis.Frequently Asked QuestionsQ: What should I do if the sample ΔA <sub> test </sub> is too high or too low?A: If the sample ΔA test is greater than the ΔA standard of the 100 µM standard, the H₂O₂ content in the sample is too high. Dilute the sample appropriately with Assay Buffer (1×) (multiply by the dilution factor in the calculation). If the sample ΔA test is less than 0.005, increase the sample amount... Read More | Product Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 andProduct Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 and α1-4 fucosyl linkages in these substrates without the need to remove sialic acid moieties.For removing core fucose linked α-(1-6) to the core GlcNAc of a GlcNAc-GlcNAc disaccharide structure we recommend our Alpha-(1-6) Fucosidase.• Non-sialidase dependant hydrolysis of antennary fucose moieties• Effective on both glycopeptides and free glycans• Highly specific (α1-3,4 fucosylated glycans)• Kit includes enzyme plus reaction buffer.• Sufficient for up to 50 samplesα(1-3,4) Fucosidase is useful for:nbsp;nbsp;Fucose linkage determinationnbsp;nbsp;Deglycosylating glycoproteins with Lewis structuresContentsAlpha-(1-3,4)-Fucosidase – 200 mM citrate buffer pH 6 containing 250 mM NaCl5x Reaction Buffer – 250 mM sodium phosphate pH 6... Read More | DescriptionIt contains a set of six different heterogeneous palladium catalysts, useful for rapid screening of catalysis conditions. It is in sampler format with individual components packaged for multiple experiments and mini scale-up. The cost of the kit is less than the total cost of individual DescriptionIt contains a set of six different heterogeneous palladium catalysts, useful for rapid screening of catalysis conditions. It is in sampler format with individual components packaged for multiple experiments and mini scale-up. The cost of the kit is less than the total cost of individual components.Catalysis Screening Kits... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665989Component240 TStorageN665989AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665989BlIndex N901-N924 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle.Note: The amount of individual primers used is 1 µl, each N7-endProducts contentN665989Component240 TStorageN665989AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665989BlIndex N901-N924 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle.Note: The amount of individual primers used is 1 µl, each N7-end primer can perform 10 DNA library constructs, and each kit can perform 240 DNA library constructs. Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. ProcedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol.Index N501 Primer for IlluminaIndex N901-N996 Primer for Illumina... Read More |