| Description | IntroductionHexokinase (HK) is widely present in animals, plants, microorganisms, and cultured cells. It is the first key enzyme in the glucose degradation pathway, catalyzing the conversion of glucose to glucose-6-phosphate, which is the intersection point of glycolysis and the pentose phosphate IntroductionHexokinase (HK) is widely present in animals, plants, microorganisms, and cultured cells. It is the first key enzyme in the glucose degradation pathway, catalyzing the conversion of glucose to glucose-6-phosphate, which is the intersection point of glycolysis and the pentose phosphate pathway.Assay PrincipleHK catalyzes the synthesis of Glucose-6-Phosphate (G6P) from Glucose. Glucose-6-Phosphate Dehydrogenase (G6PDH) then further catalyzes the dehydrogenation of G6P, generating NADPH. NADPH has a characteristic absorption peak at 340 nm.Component50TStorageExtraction Buffer60 mL2-8℃Reagent 130 mL2-8℃Reagent 21EA2-8℃Reagent 35 mL2-8℃Reagent 41EA-20℃Reagent 51EA-20℃Reagent 61EA-20℃Reagent 2: Powder × 1 bottle. Dissolve in 30 mL distilled water before use. Aliquot and store unused portions at -20°C. Avoid repeated freeze-thaw cycles.Reagent 4: Powder × 1 tube. Dissolve in 4 mL distilled water before use. Aliquot and store unused portions at -20°C. Avoid repeated freeze-thaw cycles.Reagent 5: Powder × 1 tube. Dissolve in 2 mL distilled water before use. Aliquot and store unused portions at -20°C. Avoid repeated freeze-thaw cycles.Reagent 6: Powder × 1 tube. Dissolve in 250 µL Reagent 1 and 250 µL distilled water before use. Aliquot and store unused portions at -20°C. Avoid repeated freeze-thaw cycles.Required Materials and Equipment (Not Provided)UV spectrophotometer, constant temperature water bath, benchtop centrifuge, adjustable pipettes, 1 ml quartz cuvette, mortar and pestle, ice, and distilled water.Sample Preparation:Bacteria or Cultured Cells:Collect cells by centrifugation and discard the supernatant.Add Extraction Buffer at a ratio of 1 ml per 5-10 million cells (e.g., 1 ml for 5 million cells).Sonicate on ice (20% power or 200W, pulse 3s on/10s off, repeat 30 times).Centrifuge at 8000 g, 4°C for 10 min. Collect the supernatant and keep it on ice for assay.Tissues:Homogenize tissue on ice in Extraction Buffer at a ratio of 1:5-10 (w/v) (e.g., 0.1 g tissue in 1 ml buffer).Centrifuge at 8000 g, 4°C for 10 min. Collect the supernatant and keep it on ice for assay.Serum (or Plasma) Samples:Assay directly.Assay Procedure:Preheat the spectrophotometer for at least 30 min. Set wavelength to 340 nm. Zero with distilled water.Pre-warm Reagents 1, 2, 3, 4, and 5 to 37°C (for mammalian samples) or 25°C (for other species) for 10 min.Pipette into a 1 ml quartz cuvette in the following order:ReagentVolume (µL)Reagent 1400Reagent 2400Reagent 380Reagent 480Reagent 540Reagent 68Sample30Mix immediately upon sample addition and start the timer.Record the initial absorbance (A₁) at 20 seconds and the final absorbance (A₂) at 5 minutes and 20 seconds (320 sec total) at 340 nm.Calculate ΔA = A₂ - A₁.Notes:To minimize operational error, it is recommended to pre-mix Reagents 1, 2, 3, 4, and 5 in the stated proportions. Pre-warm this Master Mix for 10 min. Then add 30 µl sample + 8 µl Reagent 6 + 1 ml Master Mix to the cuvette. Mix and proceed with the assay.HK activity varies across different tissues. Perform a pilot test with 1-2 samples before formal assay. If ΔA > 0.5, the tissue activity is too high. Dilute the supernatant with Extraction Buffer (include dilution factor D in calculations) or shorten the reaction time to 2 min to ensure ΔA < 0.5 and improve detection sensitivity.HK Activity Calculation:General Parameters:Vₜₒₜₐₗ (Total reaction volume) = 1.038 × 10⁻³ L (1038 µL)ε (NADPH molar extinction coefficient) = 6.22 × 10³ L/mol/cmd (Cuvette light path) = 1.0 cmVₛₐₘₚₗₑ (Sample volume in reaction) = 0.03 mL (30 µL)T (Reaction time) = 5 minCpr (Sample protein concentration, mg/mL)W (Sample mass, g)Vₛₐₘₚₗₑₜₒₜₐₗ (Total extract volume) = 1.0 mL (for tissue/cell calculations)500 (Cell/Bacteria count in millions for example calculation: 5 million)1. For Serum (Plasma):Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per ml of serum.Calculation:HK Activity (nmol/min/ml) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ Vₛₐₘₚₗₑ ÷ TSimplified Formula: HK (nmol/min/ml) = 1113 × ΔA2. For Tissues, Bacteria, or Cells:a. Based on Sample Protein Concentration:* Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per mg of protein.* Calculation:HK Activity (nmol/min/mg prot) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (Vₛₐₘₚₗₑ × Cpr) ÷ TSimplified Formula: HK (nmol/min/mg prot) = 1113 × ΔA ÷ Cprb. Based on Sample Fresh Weight:* Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per gram of fresh tissue.* Calculation:HK Activity (nmol/min/g fresh weight) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (W × Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ) ÷ TSimplified Formula: HK (nmol/min/g fresh weight) = 1113 × ΔA ÷ Wc. Based on Bacterial or Cell Density:* Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per 10⁴ cells.* Calculation (example for 5 million cells in 1 ml extract):HK Activity (nmol/min/10⁴ cell) = [ΔA × Vₜₒₜₐₗ ÷ (ε × d) × 10⁹] ÷ (500 × Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ) ÷ TSimplified Formula: HK (nmol/min/10⁴ cell) = 2.226 × ΔAPrecautionsPerform a pilot assay with 2-3 samples expected to have significant activity differences before the formal determination... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Cell viability and cytotoxicity assays are usually used for drug screening and compound cytotoxicity testing. The CCK-8 kit uses highly water-soluble tetrazolium salt ( called WST-8 ) to produce water-soluble WST-8 for cell proliferation and cytotoxicity assays. Unlike MTT, WST-8 and WST-8 have no Cell viability and cytotoxicity assays are usually used for drug screening and compound cytotoxicity testing. The CCK-8 kit uses highly water-soluble tetrazolium salt ( called WST-8 ) to produce water-soluble WST-8 for cell proliferation and cytotoxicity assays. Unlike MTT, WST-8 and WST-8 have no cytotoxicity in cell culture medium, so multiple downstream experiments can be performed using the same detection plate. CCK-8 method is a convenient colorimetric method for the determination of cell viability. It does not need the solubilization process and only needs the least steps to provide the results. The CCK-8 method can be used for the determination of 96-well microplates and high-throughput screening of 384-well microplates. Advantage：At present, the commercially available liquid CCK-8 kits generally have defects such as harsh storage conditions ( -4C or -20 ), unstable use in different pH ranges, and easy deterioration ( discoloration or precipitation ). The solid instant CCK-8 kit adopts a new formula and Swiss process, which overcomes these shortcomings of the liquid CCK-8 kit. It can be stored at room temperature for a long time ( > 3 years ), ready to use, stable in a wide pH range, and the experimental results are more reliable. Compared with the liquid CCK-8 kit, the solid-soluble CCK-8 kit has higher sensitivity and the biological response time is shortened by half.Application scope:It can be used for drug screening, cell proliferation assay, cytotoxicity assay, tumor drug sensitivity test and activity detection of biological factors. Operating instructions:This reagent kit can be used for drug screening, cell proliferation assay, cytotoxicity assay, tumor drug sensitivity assay, and activity detection of biological factors.1. Carefully and slowly tear along the gap in the packaging bag;2. Pour all the powder in the bag into a clean container containing 10mL of ultrapure water, shake continuously for 1 minute, and use it when the solid is completely dissolved;3. Unused reagents must be stored at low temperatures below 4 ℃.Equipment required for testing:Enzyme reader 96 well plate with 450-490 nm filter;Carbon dioxide incubator;96 well plate, sterilized transparent plate for cell detection;Multi channel pipette (8 or 12 channels: 10-100 µ l);Blood cell counter or cell counter.Cell viability testing:1. Inoculate cell suspension (100 µ l/well) into a 96 well plate and pre culture the plate in a carbon dioxide incubator for 24 hours (37 ℃, 5% CO2);2. Add 10 µ l of CCK-8 solution to each well (be careful not to generate bubbles in the well as it may affect the reading of OD value);3. Incubate the culture plate in the incubator for 1-4 hours;4. Measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader;5. If the OD value is not determined temporarily, 10 µ l of 0.1M HCI solution or 1% w/v SDS solution can be added to each well, and the culture plate can be covered and stored in the dark at room temperature. Within 24 hours of measurement, the absorbance will not change.Cell proliferation toxicity testing:1. Inoculate cell suspension (100 µ l/well) into a 96 well plate and pre culture the plate in an incubator for 24 hours (37 ℃, 5% CO2);2. Add 10ul of different concentrations of the substance to be tested to the culture plate;3. Incubate the culture plate in the incubator for an appropriate period of time (e.g. 6, 12, 24, or 48 hours);4. Add 10 µ l of CCK-8 solution to each well (be careful not to generate bubbles in the well as they may affect the reading of the OD value);5. Incubate the culture plate in the incubator for 1-4 hours;6. Measure the absorbance at 450nm using an enzyme-linked immunosorbent assay (ELISA) reader;7. If the OD value is not determined temporarily, 10 µ l of 0.1M HCI solution or 1% w/v SDS solution can be added to each well, and the culture plate can be covered and stored in the dark at room temperature. Within 24 hours of measurement, the absorbance will not change.Calculation method for cell survival rate/inhibition rate:Cell survival rate=[As Ab)/(Ac Ab)] x 100%Inhibition rate=[(Ac As)/(Ac Ab)] x 100%As: absorbance of experimental wells (including cells, culture medium, CCK-8 solution, and drug solution);Ac: absorbance of control wells (including cells, culture medium, CCK-8 solution, without drugs);Ab: Blank well absorbance (including culture medium and CCK-8 solution, excluding cells and drugs).Points for attention： 1.Unused reagents must be stored at low temperature below 4 °C, and stored in the dark at-20 °C for two years after unpacking, so as to avoid repeated thawing ; 2.The culture time of CCK-8 is generally 1-4 hours, but the naked eye can be taken out to observe the color degree in about 30 minutes. According to the cell type, the conditions need to be explored. The best reaction time of CCK-8 is based on the best time of specific color development.3. It is recommended to do a few holes to explore the number of inoculated cells and the culture time after adding CCK-8 reagent ; 3.The WST-8 in this kit will react with reducing agents ( such as some antioxidants ) to interfere with the detection. Before the cell proliferation-toxicity test, the background OD can be checked to confirm whether there is a reducing agent in the substance to be tested. If the effect of reducing agent needs to be removed, the fresh medium can be replaced before adding CCK-8 ( remove the medium, wash the cells twice with the medium, and then add the new medium ) ; 4.Phenol red in the medium does not affect the experimental results, and the absorbance of phenol red can be eliminated by deducting the absorbance of the background in the blank hole during calculation, so it will not affect the detection. 5.It is recommended to use a multi-channel pipette to reduce the difference between parallel holes. When adding CCK-8 reagent, it is recommended to add it obliquely to the wall of the culture plate, not to insert it under the liquid surface of the medium, which is easy to produce bubbles and interfere with OD determination. 6.If the drug contains metal, it has an effect on the color of CCK-8. The final concentration of 1mM lead chloride, ferric chloride and copper sulfate will inhibit the color reaction of 5 %, 15 % and 90 %, and reduce the sensitivity. If the final concentration is 10mM, the color reaction will be 100 % inhibited ; 7.When using a 96-well plate for detection, if the cell culture time is long, attention should be paid to the evaporation problem. On the one hand, because a circle around the 96-well plate is the easiest to evaporate, the method of discarding the surrounding circle can be adopted, and the same amount of PBS, water or culture medium can be added. On the other hand, the 96-well plate can be placed near the water source in the incubator to alleviate evaporation ; 8.When using standard 96-well plates, the minimum inoculation amount of adherent cells is at least 1,000 cells / well ( 100µl medium ). The sensitivity of detecting white blood cells is relatively low, so it is recommended that the inoculation amount should not be less than 2,500 cells / well ( 100 µl medium ). If you want to use a 24-well plate or a 6-well plate experiment, first calculate the corresponding inoculation amount per well, and add the CCK-8 solution according to 10 % of the total volume of the medium per well ; 9.Cell culture time varies according to the type and number of cells ( per well ), usually the color of white blood cells is weak, requiring a longer culture time ( 4 hours ) and a large number of cells ( ~ 105 cells / well ) ; 10.CCK-8 reagent is very low toxic to cells. The continuous reaction between it and dehydrogenase in living cells makes the color of the solution deepen and the OD value increase. The following methods can terminate the CCK-8 reaction ( 96-well plate ) : a ) After the color reaction, the culture plate was placed in a refrigerator at 4 ° C ; b ) 10µL 0.1MHCL solution was added to each well ; c ) 10 µL 1 % ( w / v ) SDS ( sodium dodecyl sulfate ) solution was added to each well. After the reaction stopped, the OD value should be measured within 24 hours. 11.To determine the specific number of cells, it is recommended to do the standard curve at the same time... Read More | Product contentY666144Component50 TStorageY666144ABuffer P115 mLRTY666144BBuffer P215 mLRTY666144CBuffer N320 mLRTY666144DBuffer PS15 mLRTY666144EBuffer PB10 mLRTY666144FBuffer PW (concentrate)10 mLRTY666144GBuffer EB10 mLRTY666144HGlass Beads2 gRTY666144IRNase A (10mg/mL)150 µLRTY666144JSpin Product contentY666144Component50 TStorageY666144ABuffer P115 mLRTY666144BBuffer P215 mLRTY666144CBuffer N320 mLRTY666144DBuffer PS15 mLRTY666144EBuffer PB10 mLRTY666144FBuffer PW (concentrate)10 mLRTY666144GBuffer EB10 mLRTY666144HGlass Beads2 gRTY666144IRNase A (10mg/mL)150 µLRTY666144JSpin Columns DM with Collection Tubes50 setsRTProductsThis kit is improved on the basis of common alkaline lysis method, the glass beads can effectively break the yeast cell wall, the new silica matrix membrane and buffer system can efficiently and specifically bind the plasmid DNA, and at the same time can maximize the removal of proteins and other impurities, the whole process is convenient and fast, no need to use toxic and harmful reagents, and can be processed at the same time for multiple samples. In addition to yeast cells, it can also be used in E. coli. Plasmid DNA extracted with this kit can be used in various molecular biology experiments, such as ligation, transformation, sequencing and library screening.Self-contained reagents: β-mercaptoethanol, anhydrous ethanol.Pre-experiment Preparation and Important Notes1. All components can be stably stored in dry, room temperature (15-30℃) environment for 1 year, the adsorption column can be stored at 2-8℃ for a longer period of time, and Buffer P1 with RNase A can be stably stored at 2-8℃ for 6 months.2. Before the first use, add all the RNase A solution to Buffer P1, mix well, and store at 2-8℃.3. Anhydrous ethanol should be added to Buffer PW before first use according to the instructions on the reagent bottle label.4. Before use, please check whether Buffer P2 and Buffer N3 are crystallized or precipitated. If there is any crystallization or precipitation phenomenon, it can be clarified by taking a water bath at 37℃ for a few minutes to restore the clarity.5. Be careful not to touch Buffer P2 and Buffer N3 directly, and tighten the lid immediately after use.6. The amount of plasmid extracted is related to the yeast strain, plasmid copy number, culture conditions, etc. Usually, yeast plasmid copy number is very low, which is difficult to be detected by electrophoresis or spectrophotometer method.Procedure1. Take 1-5 ml of yeast culture (maximum 5×107 yeast cells, generally for Saccharomyces cerevisiae OD = 1.0, equivalent to 1-2×107 cells/ml) and add it to a centrifuge tube (self-provided), centrifuge for 30 seconds at 12,000 rpm (~13,400×g), collect the bacterial precipitate, and aspirate as much as possible to discard the supernatant.2. Add 250µl Buffer P1 to the bacterium (please check if RNase A has been added first) and resuspend the precipitate.3. Add 40mg of Glass Beads to the above mixture and vortex and shake for 10 minutes.4. Add 250 µl of Buffer P2 to the centrifuge tube, mix gently by turning up and down 6-8 times, and let stand at room temperature for 5-10 minutes, at which time the bacterial solution should become clear and viscous.Note: Mix gently, do not shake violently, so as not to interrupt the genomic DNA, resulting in genomic DNA fragments mixed in the extracted plasmid. If the solution does not become clear, it suggests that the amount of bacteria may be too large and the lysis is not complete, and the amount of bacteria should be reduced.5. Add 350 µl of Buffer N3 to the centrifuge tube and immediately mix gently up and down 6-8 times, at which point a white flocculent precipitate appears, and centrifuge at 12,000 rpm for 20 minutes.Note: Buffer N3 should be mixed immediately after addition to avoid localized precipitation.6. Column Equilibration: Add 200 µl of Buffer PS to the Spin Columns DM in the collection tube, centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid from the collection tube, and place the column back into the collection tube.7. Add the supernatant from step 5 to the adsorbent column that has been loaded into the collection tube, taking care not to aspirate the precipitate.Note: The maximum volume of the adsorption column is 750 µl, and the solution is passed through the column in 2 times.8. Centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube and place the adsorption column back into the collection tube.9. Add 150 µl Buffer PB to the adsorbent column, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.10. Add 750 µl Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first), centrifuge at 12,000 rpm for 1 minute, and pour off the waste liquid in the collection tube.11. Place the column back into the recovery collection tube and centrifuge at 12,000 rpm for 2 minutes, pouring off the waste liquid. Leave the column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).12. Place the adsorbent column in a new centrifuge tube, add 50-100 µl of Buffer EB to the center of the adsorbent membrane dropwise, let it stand at room temperature for a few minutes, centrifuge at 13,000 rpm for 1 minute, and collect the plasmid solution into the centrifuge tube. Store the plasmid at -20°C.Attention:1) To increase the recovery efficiency of the plasmid, the resulting solution can be reintroduced into the adsorbent column, left at room temperature for a few minutes, centrifuged at 13,000 rpm for 1 minute, and the plasmid solution collected into a centrifuge tube.2) When the plasmid copy number is low or >10 kb, Buffer EB is preheated at 65-70°C in a water bath, which can increase the extraction efficiency.3) Usually yeast plasmids have very low copy number and are difficult to detect by electrophoresis or spectrophotometry. If the extracted plasmid is to be used in the next step of the experiment, it is usually recommended to use 1-5µl of the plasmid as PCR template, and 5-10µl of the plasmid for transformation of E. coli.4) Commercial high transformation efficiency receptor cells should be used for transformation of E. coli... Read More |