| Description | Inquire | Product Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 andProduct Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 and α1-4 fucosyl linkages in these substrates without the need to remove sialic acid moieties.For removing core fucose linked α-(1-6) to the core GlcNAc of a GlcNAc-GlcNAc disaccharide structure we recommend our Alpha-(1-6) Fucosidase.• Non-sialidase dependant hydrolysis of antennary fucose moieties• Effective on both glycopeptides and free glycans• Highly specific (α1-3,4 fucosylated glycans)• Kit includes enzyme plus reaction buffer.• Sufficient for up to 50 samplesα(1-3,4) Fucosidase is useful for:nbsp;nbsp;Fucose linkage determinationnbsp;nbsp;Deglycosylating glycoproteins with Lewis structuresContentsAlpha-(1-3,4)-Fucosidase – 200 mM citrate buffer pH 6 containing 250 mM NaCl5x Reaction Buffer – 250 mM sodium phosphate pH 6... Read More | DescriptionThe 200 nm Coupling Kit makes conducting lateral flow tests and biomolecule separation (including cell separation) easier and more flexible. The Kit contains AnteoBind™activated 200 nm magnetic particles that give you increased antibody binding capacity and functionality, while the DescriptionThe 200 nm Coupling Kit makes conducting lateral flow tests and biomolecule separation (including cell separation) easier and more flexible. The Kit contains AnteoBind™activated 200 nm magnetic particles that give you increased antibody binding capacity and functionality, while the included blocking buffer decreases background noise.Reduce reagent preparation time; remove traditional surface preparation steps such as EDC and replace these steps with the 200 nm pre-activated magnetic particles provided. This Kit reduces aggregation and gives you the freedom and ability to produce multifunctional particles for diverse applications, including dual labelling.For lateral flow tests, magnetic particles are easier to handle than gold. Magnetic separation removes the need to perform centrifugation and filtration concentration. Magnetic particles can provide greater sensitivity than gold during lateral flow tests.Binding Capacity and Polydisperity IndexBinding Capacity: > 50 µg IgG/mgPolydispersity Index (PdI)*: < 0.3* The Polydispersity Index (PdI) is dimensionless and determined using Dynamic Light Scattering (DLS). The PdI is scaled such that values smaller than 0.05 are rarely seen and values greater than 0.7 indicate that the sample has a very broad size distribution and poor monodispersity.Particle based Immunoassays, Lateral Flow, Bioseparations and Immunoprecipitation... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentProducts IntroductionThis product uses the principle that the difference between the concentration of salt ions inside and outside the cell can cause the cell membrane to burst to lyses the cell and releases the genomic DNA, without the need of extracting and purifying the genomic Products contentProducts IntroductionThis product uses the principle that the difference between the concentration of salt ions inside and outside the cell can cause the cell membrane to burst to lyses the cell and releases the genomic DNA, without the need of extracting and purifying the genomic DNA.This product is suitable for a variety of sources of samples, and can be used as a template for PCR and qPCR experiments after sample processing, and can achieve the effect of the purified DNA used as a template for PCR and qPCR experiments. Usage1. Depending on the type of sample, prepare the appropriate sample size according to the table below.2. Add the sample to a 1.5-mi centrifuge tube and add the recommended volume of Solution A as shown in the table below. Vortex for 20 s and allow to stand at room temperature for 3-5 min or incubate in a metal bath at 95°C for 3-5 min as recommended in the table below.3. After the sample has been sufficiently lysed (samples incubated in a metal bath at 95°C should be brought to room temperature), add the recommended volume of Solution B as shown in the table below and vortex for 30s.4. Store processed samples at 4°C if the next test is to be performed within 2 hours, or at -20°C if the next test cannot be performed immediately.take note of1) Depending on the requirements of the experimental conditions, the amount of samples can be expanded or reduced, and the amount of Solution A and Solution B can be increased in equal proportions.2) For blood and cell samples, the temperature of room temperature lysis is required to be around 25C. If the ambient temperature does not reach 25°, the lysis time can be extended appropriately, or the vortex shaking time can be extended to ensure that the samples are fully lysed. If there is no relevant professional instrument, the centrifuge tube can be shaken vigorously to ensure adequate lysis.3) After the tissue sample is made into tissue homogenate by adding 10 times the volume of saline, it can be processed in the same way as blood samples.4) Strictly prohibit the use of expired products, please do not mix different reagents.5) laboratory supplies should be regularly cleaned and 10% of the 84 disinfectant solution or ultraviolet lamp for anti-pollution treatment, special areas dedicated to prohibit cross use, so as to avoid contamination, the end of the test, the bench should be cleaned immediately... Read More |