| Description | IntroductionCreatine Kinase (CK) is primarily found in tissues such as the heart, muscle, and brain. It reversibly catalyzes the transphosphorylation reaction between creatine and ATP, playing a vital role in energy transfer, muscle contraction, and ATP regeneration. It is a crucial clinical IntroductionCreatine Kinase (CK) is primarily found in tissues such as the heart, muscle, and brain. It reversibly catalyzes the transphosphorylation reaction between creatine and ATP, playing a vital role in energy transfer, muscle contraction, and ATP regeneration. It is a crucial clinical indicator for diagnosing heart and brain diseases.Assay PrincipleCK catalyzes the conversion of Phosphocreatine and ADP to Creatine and ATP. Hexokinase then catalyzes the reaction of ATP with Glucose to form Glucose-6-Phosphate (G6P). Subsequently, Glucose-6-Phosphate Dehydrogenase (G6PDH) catalyzes the oxidation of G6P with NADP⁺ to generate NADPH, leading to an increase in absorbance at 340 nm.Component50TStorageExtraction Buffer60 mL2-8℃Reagent 11EA2-8℃. Store in the dark.Reagent 215 mL2-8℃Reagent 1: Powder in one bottle. Store at 4°C protected from light. Dissolve in 15 mL distilled water before use.Working Solution: Prepare immediately before use by mixing the dissolved Reagent 1 and Reagent 2 at a 1:1 ratio. Incubate the Working Solution at 37°C for 2 minutes prior to use.Required Materials and Equipment (Not Provided)Balance, refrigerated centrifuge, constant temperature water bath, UV spectrophotometer, 1 ml quartz cuvette, and distilled water.Crude Enzyme Extraction:Tissue Samples: Homogenize the tissue on ice in Extraction Buffer at a ratio of 1:5-10 (w/v) (e.g., weigh ~0.1g tissue, add 1 mL Extraction Buffer). Centrifuge the homogenate at 10,000 g, 4°C for 15 min. Collect the supernatant and keep it on ice for assay.Serum Samples: Assay directly.Assay Procedure:Preheat the UV spectrophotometer for at least 30 minutes. Set the wavelength to 340 nm. Zero the instrument with distilled water.In a 1 ml quartz cuvette, add:200 µl sample300 µl distilled water500 µl pre-warmed (37°C) Working SolutionMix thoroughly and immediately record the initial absorbance (A₁) at 340 nm. Record the absorbance again (A₂) after exactly 1 minute at 37°C. Calculate ΔA = A₂ - A₁.CK Enzyme Activity Calculation:General Parameters:ε (NADPH molar extinction coefficient) = 6220 L/mol/cmd (Cuvette light path) = 1.0 cmVₜₒₜₐₗ (Total reaction volume) = 1.0 mL (1000 µL)Vₛₐₘₚₗₑ (Sample volume in reaction) = 0.2 mL (200 µL)T (Reaction time) = 1 minCpr (Sample protein concentration, mg/mL)W (Sample mass, g)Vₛₐₘₚₗₑₜₒₜₐₗ (Total extract volume) = Assumed 1 mL for tissue calculations1. Based on Tissue Protein Content:Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per mg of protein at 37°C, pH 7.0.Calculation:CK Activity (nmol/min/mg prot) = [ΔA / (ε × d)] × Vₜₒₜₐₗ ÷ (Vₛₐₘₚₗₑ × Cpr) ÷ TSimplified Formula: CK (nmol/min/mg prot) = 804 × ΔA ÷ Cpr2. Based on Tissue Sample Mass:Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per gram of fresh tissue at 37°C, pH 7.0.Calculation:CK Activity (nmol/min/g fresh weight) = [ΔA / (ε × d)] × Vₜₒₜₐₗ ÷ (Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ × W) ÷ TSimplified Formula: CK (nmol/min/g fresh weight) = 804 × ΔA ÷ W3. Based on Serum:Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per liter of serum at 37°C, pH 7.0.Calculation:CK Activity (nmol/min/L) = [ΔA / (ε × d)] × Vₜₒₜₐₗ ÷ Vₛₐₘₚₗₑ ÷ TSimplified Formula: CK (nmol/min/L) = 804 × ΔANotesBefore the formal assay, it is essential to perform a pilot test with 2-3 samples expected to have significant differences in activity.The prepared Working Solution is stable at 4°C for 7 days. However, it is recommended to use it as soon as possible after preparation.CK in serum is unstable. Determine the activity as soon as possible after sample collection. It can be stored protected from light at 4°C for up to 24 hours.Sample protein content needs to be determined separately. A BCA Protein Assay Kit can be used for this purpose.If the absorbance value (ΔA) is greater than 0.5, dilute the sample appropriately with Extraction Buffer and account for the dilution factor (D) in the calculation formulas (e.g., 804 × ΔA × D ÷ Cpr)... Read More | DescriptionCobalt is a transition metal that serves as a trace dietary mineral for all multicellular organisms. Cobalt is an important cofactor for the Vitamin B12class of compounds where it occupies the center of the vitamin B12corrin ring. Cobalt can also be coordinated in the active site of the DescriptionCobalt is a transition metal that serves as a trace dietary mineral for all multicellular organisms. Cobalt is an important cofactor for the Vitamin B12class of compounds where it occupies the center of the vitamin B12corrin ring. Cobalt can also be coordinated in the active site of the non-corrin containing metalloenzyme methionine aminopeptidase.Suitability: Suitable for quantitating cobalt concentrations in a variety of samplesPrinciple: The Cobalt Assay kit provides a simple and direct procedure for measuring cobalt in a variety of samples. In this assay, cobalt reacts with 2-mercaptoethanol under basic conditions to form a complex with a strong absorbance at 475 nm. Interference from the metal ions Fe2+, Cu2+, Ni2+, Zn2+, and Mn2+is <10% at this wavelength. This assay gives a linear range of 10-50 nmoles of cobalt.}Preparation instructionsSuitable for quantitating cobalt concentrations in a variety of samplesPrincipleThe Cobalt Assay kit provides a simple and direct procedure for measuring cobalt in a variety of samples. In this assay, cobalt reacts with 2-mercaptoethanol under basic conditions to form a complex with a strong absorbance at 475 nm. Interference... Read More | Product content C665709Component50 TStorageC665709ABuffer CL45 mLRTC665709BBuffer CB (concentrate)60 mLRTC665709CBuffer GW1 (concentrate)13 mLRTC665709DBuffer GW2 (concentrate)15 mLRTC665709EBuffer EBL10 mLRTC665709FProteinase K100 mgRTC665709GProteinase K Storage Buffer5 mLRTC665709HSpin Columns DFProduct content C665709Component50 TStorageC665709ABuffer CL45 mLRTC665709BBuffer CB (concentrate)60 mLRTC665709CBuffer GW1 (concentrate)13 mLRTC665709DBuffer GW2 (concentrate)15 mLRTC665709EBuffer EBL10 mLRTC665709FProteinase K100 mgRTC665709GProteinase K Storage Buffer5 mLRTC665709HSpin Columns DF with Collection Tubes50 EA2-8℃C665709ICentrifuge Tubes (L-1.5 mL)50 EART Product IntroductionThis kit is suitable for the extraction of free DNA from fresh or frozen serum, plasma, lymph fluid and other cell-free body fluids.This kit adopts centrifugal adsorption columns that can specifically bind nucleic acids and a unique buffer system.After the sample is lysed, the free DNA binds to the silica gel membrane under high salt conditions, and the free DNA elutes from the silica gel membrane at low salt and high pH. The product can handle liquid samples of 0.1-1 ml, and the elution volume of the configured high-efficiency micro adsorption column can be as low as 20 µl. The purified DNA is of high yield and quality, with maximum removal of proteins, pigments, lipids, and other inhibitors, and the rate of free DNA yield is highly dependent on the type of samples, storage conditions, time, and inter-individual variations. The quality of free DNA obtained from purification is stable and reliable, and can be directly used in molecular biology experiments such as PCR, fluorescence quantitative PCR and second generation sequencing.Self-contained reagents: anhydrous ethanol, isopropanol.Pre-experiment Preparation and Important NotesAdd 5 ml of Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time.Repeated freezing and thawing of the sample should be avoided, as this can lead to a decrease in extraction.This kit can extract 0.1-1 ml of liquid samples.Before use, please check Buffer CL, Buffer CB for crystallization or precipitation, if there is any crystallization or precipitation, please re-dissolve Buffer CL, Buffer CB by incubation at 56℃ in a water bath.Before first use isopropyl alcohol should be added to Buffer CB according to the instructions on the reagent bottle label, mixed well, and labeled on the reagent bottle label.Before the first use, anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the label of the reagent bottle, mixed well, and labeled on the label of the reagent bottle.Preheat the water bath to 60°C before starting the experiment.The elution buffer Buffer EBL can be preheated to 60°C and used.Operation stepsAdd 20 µl of Proteinase K to the centrifuge tube (supplied).Add 200 µl of serum/plasma sample.Note: When the sample volume exceeds 200 µl, please increase the amount of Proteinase K, Buffer CL and Buffer CB reagents in equal proportions, and the specific amount of reagents added can be referred to the attached table.3. Add 160 µl Buffer CL, mix upside down and shake vigorously for at least 30 seconds.4. Incubate at 60°C for 30 minutes, during which time mixing was inverted several times.Note: Incubation of 200µl serum/plasma samples at 60°C for 10-15 minutes is sufficient.Add 360 µl of Buffer CB (check for addition of isopropanol before use) and shake until thoroughly mixed.Ice bath for 5 minutes and centrifuge briefly to concentrate the liquid on the walls and wall caps to the bottom of the tube.Add all of the solution obtained in step 6 to the adsorption columns (Spin Columns DF) that have been loaded into the collection tubes, and if the solution cannot be added all at once, it can be transferred in several times. centrifuge the columns at 12,000 rpm for 1 minute, pour off the waste solution from the collection tubes, and put the columns back into the collection tubes.Add 500µl of Buffer GW1 to the adsorbent column (check that anhydrous ethanol is added before use),centrifuge the column at 12,000rpm for 30 seconds, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.Add 750 µl Buffer GW2 to the adsorbent column (check that anhydrous ethanol is added before use), centrifuge at 12,000 rpm for 30 seconds, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.10. Add 750 µl of anhydrous ethanol to the adsorbent column and centrifuge at 12,000 rpm for 30 s. Pour off the waste liquid in the collection tube and put the adsorbent column back into the collection tube.11. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can interfere with the subsequent enzymatic reaction.12. Place the adsorption column in a new centrifuge tube, add 20-100 µl Buffer EBL or sterilized water to the middle part of the adsorption column overhanging the column, leave it at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20℃.Note: 1) If the downstream experiment is sensitive to pH, you can use sterilized water for elution. The pH value of the eluent has a great influence on the elution efficiency, if water is used as the eluent should ensure that its pH value is 7.0-8.5 (you can use NaOH to adjust the pH value of water to this range), and the elution efficiency is not high when the pH value is lower than 7.0.2) Preheat the elution buffer BufferEBL to 60℃ and use it, and incubate it at room temperature for 5 minutes before centrifugation to increase the yield.3) If the final concentration of DNA is to be increased, the resulting solution can be reintroduced into the adsorption column and left at room temperature for 2-5 minutes and centrifuged at 12,000 rpm for 1 minute.4) Because DNA preserved in water will be affected by acidic hydrolysis, for long-term storage, it is recommended to elute it with Buffer EBL and store it at -20℃.Table: Recommended reagent additions for different sample sizes... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionPhoto KitAlysis Starter Kit enables screening of 24 micro-scale simultaneous photocatalytic reactions with consistent and reproducible photon intensity. User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsComponents:Photo KitAlysis LED ControllerBlue LED DescriptionPhoto KitAlysis Starter Kit enables screening of 24 micro-scale simultaneous photocatalytic reactions with consistent and reproducible photon intensity. User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsComponents:Photo KitAlysis LED ControllerBlue LED Array (470 nm)Photo KitAlysis Reaction BlockTorque screwdriverSmall screwdriver to easily remove torqued screws after reaction is completeFeatures:Designed and tested by synthetic chemists.Controller provides repeatable milliamp selection for photon intensity0-30 mA variable LED output3 different LED options: blue (470 nm, included), green (527 nm, sold separately), and white (sold separately)Non-magnetic LED baseChemically resistant LED coverPTFE coated cablingDesigned to be used withPhoto KitAlysis High-Throughput Reaction Screening Kit(sold separately).Best when used withKitAlysis Benchtop Inertion Box(sold separately)... Read More |