| Description | IntroductionCreatine Kinase (CK) is primarily found in tissues such as the heart, muscle, and brain. It reversibly catalyzes the transphosphorylation reaction between creatine and ATP, playing a vital role in energy transfer, muscle contraction, and ATP regeneration. It is a crucial clinical IntroductionCreatine Kinase (CK) is primarily found in tissues such as the heart, muscle, and brain. It reversibly catalyzes the transphosphorylation reaction between creatine and ATP, playing a vital role in energy transfer, muscle contraction, and ATP regeneration. It is a crucial clinical indicator for diagnosing heart and brain diseases.Assay PrincipleCK catalyzes the conversion of Phosphocreatine and ADP to Creatine and ATP. Hexokinase then catalyzes the reaction of ATP with Glucose to form Glucose-6-Phosphate (G6P). Subsequently, Glucose-6-Phosphate Dehydrogenase (G6PDH) catalyzes the oxidation of G6P with NADP⁺ to generate NADPH, leading to an increase in absorbance at 340 nm.Component50TStorageExtraction Buffer60 mL2-8℃Reagent 11EA2-8℃. Store in the dark.Reagent 215 mL2-8℃Reagent 1: Powder in one bottle. Store at 4°C protected from light. Dissolve in 15 mL distilled water before use.Working Solution: Prepare immediately before use by mixing the dissolved Reagent 1 and Reagent 2 at a 1:1 ratio. Incubate the Working Solution at 37°C for 2 minutes prior to use.Required Materials and Equipment (Not Provided)Balance, refrigerated centrifuge, constant temperature water bath, UV spectrophotometer, 1 ml quartz cuvette, and distilled water.Crude Enzyme Extraction:Tissue Samples: Homogenize the tissue on ice in Extraction Buffer at a ratio of 1:5-10 (w/v) (e.g., weigh ~0.1g tissue, add 1 mL Extraction Buffer). Centrifuge the homogenate at 10,000 g, 4°C for 15 min. Collect the supernatant and keep it on ice for assay.Serum Samples: Assay directly.Assay Procedure:Preheat the UV spectrophotometer for at least 30 minutes. Set the wavelength to 340 nm. Zero the instrument with distilled water.In a 1 ml quartz cuvette, add:200 µl sample300 µl distilled water500 µl pre-warmed (37°C) Working SolutionMix thoroughly and immediately record the initial absorbance (A₁) at 340 nm. Record the absorbance again (A₂) after exactly 1 minute at 37°C. Calculate ΔA = A₂ - A₁.CK Enzyme Activity Calculation:General Parameters:ε (NADPH molar extinction coefficient) = 6220 L/mol/cmd (Cuvette light path) = 1.0 cmVₜₒₜₐₗ (Total reaction volume) = 1.0 mL (1000 µL)Vₛₐₘₚₗₑ (Sample volume in reaction) = 0.2 mL (200 µL)T (Reaction time) = 1 minCpr (Sample protein concentration, mg/mL)W (Sample mass, g)Vₛₐₘₚₗₑₜₒₜₐₗ (Total extract volume) = Assumed 1 mL for tissue calculations1. Based on Tissue Protein Content:Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per mg of protein at 37°C, pH 7.0.Calculation:CK Activity (nmol/min/mg prot) = [ΔA / (ε × d)] × Vₜₒₜₐₗ ÷ (Vₛₐₘₚₗₑ × Cpr) ÷ TSimplified Formula: CK (nmol/min/mg prot) = 804 × ΔA ÷ Cpr2. Based on Tissue Sample Mass:Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per gram of fresh tissue at 37°C, pH 7.0.Calculation:CK Activity (nmol/min/g fresh weight) = [ΔA / (ε × d)] × Vₜₒₜₐₗ ÷ (Vₛₐₘₚₗₑ / Vₛₐₘₚₗₑₜₒₜₐₗ × W) ÷ TSimplified Formula: CK (nmol/min/g fresh weight) = 804 × ΔA ÷ W3. Based on Serum:Definition: One unit of activity is defined as the amount of enzyme that generates 1 nmol of NADPH per minute per liter of serum at 37°C, pH 7.0.Calculation:CK Activity (nmol/min/L) = [ΔA / (ε × d)] × Vₜₒₜₐₗ ÷ Vₛₐₘₚₗₑ ÷ TSimplified Formula: CK (nmol/min/L) = 804 × ΔANotesBefore the formal assay, it is essential to perform a pilot test with 2-3 samples expected to have significant differences in activity.The prepared Working Solution is stable at 4°C for 7 days. However, it is recommended to use it as soon as possible after preparation.CK in serum is unstable. Determine the activity as soon as possible after sample collection. It can be stored protected from light at 4°C for up to 24 hours.Sample protein content needs to be determined separately. A BCA Protein Assay Kit can be used for this purpose.If the absorbance value (ΔA) is greater than 0.5, dilute the sample appropriately with Extraction Buffer and account for the dilution factor (D) in the calculation formulas (e.g., 804 × ΔA × D ÷ Cpr)... Read More | Inquire | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665954Component24 T96 TStorageN665954ATPS V136 µL144 µL-20℃. Avoid freeze/thaw cycle.N665954B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665954CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665954D2× Products contentN665954Component24 T96 TStorageN665954ATPS V136 µL144 µL-20℃. Avoid freeze/thaw cycle.N665954B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665954CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665954D2× PCR Mix600 µL2×1.2 mL-20℃. Avoid freeze/thaw cycle. * This kit is suitable for human genomic DNA library construction, the starting template DNA input amount is 1 ng, our company also has 50 ng and 5 ng of human genomic DNA starting transposase method library construction kit, in order to get a higher quality library, different starting amount of DNA is recommended to use different kits. Products IntroductionThis kit is developed for Illumina's high-throughput sequencing platform and provides the enzyme premix system and reaction buffer for genomic DNA library construction, including all components except PCR primers. Compared with the traditional library construction kits, this kit adopts the new transposase method for library construction, which can complete DNA fragmentation, end repair and junction reaction in one simple enzymatic reaction, significantly reducing the amount of template, reducing the number of experimental steps, and shortening the time of library construction; it adopts the high-fidelity DNA polymerase for library enrichment, and the preference-free PCR amplification can expand the coverage area of the sequence, which can be used for efficient and effective sequencing. The use of high-fidelity DNA polymerase for library enrichment and preference-free PCR amplification broadens the coverage area of the sequence and enables efficient preparation of DNA libraries for Illumina's second-generation sequencing platform. The kit is suitable for use with 1 ng of starting template DNA, and all reagents in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction.Product Features● DNA fragmentation and junction ligation in one step.● Ultra-fidelity amplification minimizes amplification preference.Provide your own instruments, kits and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. Library PCR primer kit: It is recommended to use Kangwei transposase method for second generation sequencing multi-sample primer kit.4. Anhydrous ethanol, deionized water (pH between 7.0 and 8.0).5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes.Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important Notes1. Avoid repeated freezing and thawing of reagents.2. PCR products are easily contaminated due to improper operation, resulting in inaccurate results. It is recommended to isolate the PCR reaction system preparation area from the PCR product purification area, and to use special pipettes to clean the experimental areas at regular intervals.3. Bead purification: the beads should be equilibrated to room temperature before use, all operations on the beads should be carried out at room temperature, 80% ethanol should be dispensed freshly, the beads should be rinsed and dried until the surface is free of liquid reflections and has a frosted appearance, insufficient drying of the beads will cause ethanol residue that will affect the subsequent experiments, and over-drying of the beads will affect the efficiency of DNA recovery.4. The kit is suitable for human genomic DNA library construction, if the DNA sample is a PCR product, it should be ensured that its length>.500 bp, since transposases do not work on DNA ends, it is recommended to extend the PCR product by 50-100 bp at each end of the PCR product to avoid low coverage of the ends for sequencing. Sample PreparationDNA purity requirement: A260/A280 = 1.8-2.0. Sample DNA: dissolved in ultrapure water.DNA quantification: Too much or too little DNA will affect the quality of the library. It is recommended to use Nano to test the purity of the genomic DNA and then use Qubit to test the concentration of the genome (do not use any absorbance-based assay for template quantification). Schematic diagram of DNA banking process procedureDNA fragmentation, junction reaction 1. Add the following reagents to a 200 µl PCR tube:2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows:inactivation reactionAfter the DNA is fragmented, the enzyme is still in a high active state, so it should be removed from the PCR instrument immediately and terminated by adding the Reaction Termination Buffer, in order to prevent the DNA from being fragmented too much and resulting in smaller library fragments.1. Add 3 µl of TS Buffer to the PCR tube containing the fragmentation product.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Incubate at room temperature for 5 min, or if the room temperature is too low, place the reaction on a PCR instrument at 25°C with the thermal cover closed.PCR amplification1. Add the following reagents to a 200 µl PCR tube.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube. 3. Place the above PCR tubes in the PCR instrument with the thermal cap open, and the reaction program is as follows:Selective recovery of library DNA fragmentsIt is recommended to use CombiVision Magnetic Beads DNA Purification and Recovery Kit for selective recovery of DNA fragments. When different sizes of DNA fragments are required, the amount of magnetic beads used is different, please refer to the attached table for the specific amount of magnetic beads used.(If using other brands of magnetic beads, you need to figure out the optimal amount of magnetic beads by yourself).Note: Amplification products can also be fragment length sorted and purified using the Gum Recovery Kit. If there is no special requirement for library length distribution, amplification products can also be purified directly from DNA fragments without selective recovery of DNA fragments as described on page 4 of the manual.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. Transfer the PCR products to a 1.5 ml centrifuge tube, rehydrate to 100 µl, add several volumes of magnetic beads equilibrated to room temperature, vortex for 5 seconds, and let stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, and carefully aspirate the supernatant and transfer it to a new 1.5 ml centrifuge tube.Note: Do not discard the top clear.4. Add several volumes of magnetic beads to the supernatant, vortex and shake for 5 seconds, then let stand at room temperature for 5 minutes.5. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA.Note: Do not discard the beads.6. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.7. Repeat step 6 once.8. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 20 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.9. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new tube. Table: Suggested amount of magnetic beads for different segment selection recoveryLibrary DNA fragment purificationWe recommend the use of the Kangwei Century Magnetic Bead Method DNA Purification and Recovery Kit.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. 50 µl of magnetic beads equilibrated to room temperature were added to the PCR product, vortexed and shaken for 5 seconds, and then left to stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant solution until the solution is clear (approximately 3-5 minutes), carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA. Note: Do not discard the beads.4. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the centrifuge tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.5. Repeat step 4.6. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 25 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.7. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new tube. Library quality controlDetermination of library concentrationIn order to obtain high-quality sequencing results, accurate quantification of DNA libraries is required, and the first recommendation is to use Real-timePCR methods are used for absolute quantification of DNA libraries. Additionally, fluorescent dye methods such as the Qubit method or the fluorescent dye picogreen method can be used; do not use quantification methods based on absorbance measurements here. The following approximate formula can be used to convert the molar concentration of the DNA library.Library fragment distributionThe prepared DNA libraries can be detected by agarose gel electrophoresis or Agilent 2100 Bioanalyzer.Range of segment length distributions... Read More |