| Description | Inquire | DescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences theDescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences the reverse cholesterol transport pathway.Preparation instructionsSuitable for high-throughput screening (HTS), mechanism of action (MOA) studies, and structure-activity relationship (SAR) work in CETP sources.PrincipleThe CETP RP Activity Assay uses a proprietary substrate that enables the detection of CETP-mediated neutral lipid mass transfer. The method is useful for measuring CETP activity in recombinant protein (RP) or purified CETP samples and has a high D... Read More | DescriptionThe Baran Late-Stage Toolkit is a convenient collection of 12 highly innovative reagents that are highly effective in the diversification of complex molecules. The contents in the box are 11 Baran Diversinates™and one vial of Palau′Chlor®in amounts of 100 mg each. For DescriptionThe Baran Late-Stage Toolkit is a convenient collection of 12 highly innovative reagents that are highly effective in the diversification of complex molecules. The contents in the box are 11 Baran Diversinates™and one vial of Palau′Chlor®in amounts of 100 mg each. For obtaining larger amounts of any desired kit component, see the kit component table at the bottom of the page.Useful Topics:Late Stage FunctionalizationBaran Group – Professor Product PortalPalau′ChlorDiversinates... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product DescriptionAcetyl esterase (sialate-O-acetylesterase) is a recombinant protein from Tannerella forsythia, ATCC 43037 strain, expressed in Escherichia coli. The enzyme removes acetyl groups attached via an O- group, mainly 9-, 8- and 7-. It can be used for monitoring of diacetylation of Product DescriptionAcetyl esterase (sialate-O-acetylesterase) is a recombinant protein from Tannerella forsythia, ATCC 43037 strain, expressed in Escherichia coli. The enzyme removes acetyl groups attached via an O- group, mainly 9-, 8- and 7-. It can be used for monitoring of diacetylation of sialic acids on products such as erythropoietin (EPO).The Zyme Acetyl Esterase Kit removes 9-, 8- and 7-O-acetyl groups from released sialic acids, released glycans or glycoproteins. It is commonly used for the characterization of highly-sialylated biotherapeutics such as EPO, FSH and blood clotting factors.Molecular Weight76.3 kDContentsAcetyl esterase – PBS pH7.5 buffer containing 10 mM Tris-HClReaction Buffer – 500 mM sodium acetate pH5.5Number of SamplesSufficient for up to 50 samples.Amount of SampleUp to 10 µg glycoprotein, up to 2.5 µg released glycans and up to 1 µg free sialic acid per digestion.Suitable SamplesAcetyl esterase (sialate-O-acetylesterase) can act upon complex glycoprotein samples, such as erythropoietin (EPO), bovine submaxillary mucin and oral epithelial cell-bound glycans, and on N- and O-glycans released from a glycoprotein. Either fluorescently labelled or unlabelled glycans are suitable. It can also be used on released sialic acids.Unit DefinitionOne unit (U) of acetyl esterase is defined as the amount of enzyme required to produce 300 µmole of 4-nitrophenol and acetate in 1 minute at 30°C in a buffer containing 50 mM Tris-HCl, 140 mM NaCl, pH 8.5, from 4-nitrophenyl acetate, a chromogenic esterase substrateStorageProtect from sources of heat and light. When stored correctly, the enzyme should be stable for 24 months from date of purchase. Exposure to ambient temperatures (20 – 26°C) over 3 days does not result in a reduction of enzymatic activity.ShippingThe product should be shipped at 4°C.HandlingEnsure that any glass, plastic ware or solvents used with this item are free of environmental carbohydrates. Use powder-free gloves for all sample handling procedures and avoid contamination with environmental carbohydrate.SafetyPlease read the Safety Data Sheets (SDSs) for all chemicals used. All processes involving labelling reagents should be performed using appropriate personal safety protection – safety glasses, chemically resistant gloves (e.g. nitrile), lab coat, and when appropriate, in a laboratory fume cupboard.For research use only. Not for human or drug use ApplicationAcetyl esterase (sialate-O-acetylesterase) can be used to remove 9-, 8- and 7-O-acetyl groups from released sialic acids, released glycans or glycoproteins... Read More |