| Description | Inquire | Product IntroductionBCIP (5-Bromo-4-chloro-3-indolyl phosphate) 5-bromo-4-chloro-3-indolyl-phosphate + NBT (tetrazolium nitro blue) is the best substrate for alkaline phosphatase (AP) One of the combination. Under the catalysis of alkaline phosphatase, BCIP will be hydrolyzed to produce a highly Product IntroductionBCIP (5-Bromo-4-chloro-3-indolyl phosphate) 5-bromo-4-chloro-3-indolyl-phosphate + NBT (tetrazolium nitro blue) is the best substrate for alkaline phosphatase (AP) One of the combination. Under the catalysis of alkaline phosphatase, BCIP will be hydrolyzed to produce a highly reactive product, which reacts with NBT to form an insoluble dark blue to blue-violet compound. This kit can be used for the enzymatic color development of IHC and Western Blot experiments of the AP system. Under AP catalysis, a dark blue precipitate is produced where AP conjugates are combined on tissue sections or blotting membranes. The location and expression of the target protein can be determined based on the color reaction.Product Components40×BCIP: 1 ml40×NBT: 1 mlBCIP/NBT Buffer: 40 mlPrecautions1. The working fluid should be prepared for immediate use, and the prepared working fluid will be effective within 1 hour.2. The amount of working fluid must be sufficient to ensure complete coverage of the tissue sheet or blotting membrane. To3. In order to obtain the best experimental results, be sure to optimize the experimental conditions.4. NBT is poisonous, please take necessary protective measures when using it.5. This product is only used for scientific research, not for human experiments or human treatment.Instructions1. BCIP/NBT color developing working solution preparation:According to the required amount, mix 40×BCIP, 40×NBT and BCIP/NBT Buffer in a volume ratio of 1:1:38 to form the BCIP/NBT color developing working solution.2. Color rendering:1) Blotting membrane color development: Drop the prepared working solution on the blotting membrane (or pour the blotting membrane into the BCIP/NBT color developing working solution), and incubate for 3-10 minutes at room temperature and dark. After the color development is completed, the film is immersed in water to terminate the reaction.2) Color development of tissue sections or cell slides: Drop an appropriate amount of BCIP/NBT color developing working solution on the tissue sections or cell slides that need color development, and incubate at room temperature for 3-10 minutes in the dark. Observe under the microscope to control the color development time. When the best color development effect is reached, rinse with tap water to stop the color development. After color development, the slices are counter-stained, dehydrated and transparent, and can be stored for a long time after mounting... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionGreen LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatableDescriptionGreen LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatable milliamp selection for photon intensity (sold seperately)527 nm wavelength0-30 mA variable LED outputNon-magnetic LED baseChemically resistant LED coverPTFE coated cablingPhoto Kitalysis Starter Kitrequired for operation (sold separately). Best when used withKitAlysis Benchtop Inertion Box(sold separately)... Read More |