| Description | The AO/PI Double Staining Kit is a detection system based on fluorescent nucleic acid dyes, designed to quickly and reliably distinguish live, apoptotic, and necrotic cells in biological samples. Its core principle utilizes the differences in cell membrane permeability and the specific The AO/PI Double Staining Kit is a detection system based on fluorescent nucleic acid dyes, designed to quickly and reliably distinguish live, apoptotic, and necrotic cells in biological samples. Its core principle utilizes the differences in cell membrane permeability and the specific fluorescent reactions upon binding to nucleic acids of the two dyes, Acridine Orange (AO) and Propidium Iodide (PI). AO can penetrate the cell membranes of all cell types (live, apoptotic, and necrotic). After entering the cell, AO binds to nucleic acids, but its fluorescence color depends on the target: when it binds to double-stranded DNA (dsDNA) in the nucleus, it emits green fluorescence (Ex 488 nm, Em 530 nm); whereas when it binds to single-stranded DNA (ssDNA) or RNA, it emits red fluorescence (Em >640 nm). In contrast, PI cannot penetrate cells with intact cell membranes. It only enters late apoptotic and necrotic cells, whose cell membranes have been compromised, and binds to DNA to produce red fluorescence (Ex 535 nm, Em 617 nm). Therefore, after AO/PI double staining, observation under a fluorescence microscope allows clear differentiation of cells in different states: live cells display normal green fluorescence; early apoptotic cells show bright green speckled nuclear morphology (only AO enters); late apoptotic and necrotic cells appear orange-red or strong red fluorescence due to the combined effect of AO and PI.Product InformationA1492198Components100T500TStorageQuantity Per TestA1492198AAO Staining Solution100µL500µL2-8℃, Store in the dark.1µL per 0.5-1.0 x 10⁶ cellsA1492198BPI Staining Solution500µL2500µL-20℃. Store in the dark.5µL per 0.5-1.0 x 10⁶ cellsA1492198CAO/PI Dilution Buffer10mL50mL2-8℃0.1mL per 0.5-1.0 x 10⁶ cellsNote: The recommended number of cells to stain per test is 0.5-1.0 x 10⁶ cells.Procedure1. Preparation of Working Solution(1) Take out the reagents and allow them to reach room temperature. Dilute the AO/PI Dilution Buffer 10-fold with double-distilled water before use.(2) Prepare the AO/PI Staining Working Solution: The concentration of AO stock solution in this product is 10 mg/mL, and PI stock solution is 1 mg/mL. Add 50 µL of PI stock solution and 10 µL of AO stock solution to 10 mL of diluted AO/PI Dilution Buffer. Vortex to mix well, resulting in 10 mL of AO/PI Staining Working Solution.Note: Since optimal staining conditions may vary with cell type, it is recommended that users determine the appropriate dye concentration individually based on practical conditions.2. Staininga. For Adherent Cells:(a) Seed cells in culture dishes, multi-well plates, or on coverslips, and treat the cells as required by the experimental design. Gently aspirate the medium from the wells and wash with PBS for about 10 seconds, then remove the PBS.(b) Add an appropriate volume of AO/PI Staining Working Solution, and gently swirl to ensure the dye evenly covers all cells.Note: For adherent cells cultured in 6-well plates with a confluency over 80%, it is recommended to add 1 mL of staining working solution per well. This can be optimized according to the specific experimental setup.(c) Incubate the cells at room temperature, protected from light, for 1-10 minutes.(d) Aspirate the staining solution, wash 2-3 times with PBS, then add serum-free culture medium. Observe immediately under a fluorescence microscope: observe AO-DNA green fluorescence at Ex/Em = 488/530 nm, and PI-DNA red fluorescence at Ex/Em = 535/617 nm. Alternatively, analysis by flow cytometry or detection with a fluorescence microplate reader can be performed after staining.b. For Suspension Cells:(a) After treating the cells as required by the experimental design, count the cells. Take an appropriate number of cells, centrifuge at 500 × g for 5 minutes at room temperature, gently aspirate the medium, resuspend in an appropriate amount of PBS, and centrifuge again at 500 × g for 5 minutes at room temperature to remove the PBS.(b) Add an appropriate amount of AO/PI Staining Working Solution to achieve a cell density of approximately 10⁶ cells/mL.(c) Incubate the cells at room temperature, protected from light, for 1-10 minutes.(d) Place a drop directly on a glass slide, cover with a coverslip, and observe under a microscope: observe AO-DNA green fluorescence at Ex/Em = 488/530 nm, and PI-DNA red fluorescence at Ex/Em = 535/617 nm. Alternatively, analysis by flow cytometry or detection with a fluorescence microplate reader can be performed after staining.Note: If background interference is significant, centrifuge to remove the staining solution, wash 1-2 times with PBS, and then observe under the microscope.Precautions1. AO/PI staining solutions are somewhat toxic; handle with care. 2. For your safety and health, please wear a lab coat and disposable gloves.3. Fluorescent dyes are subject to quenching; it is recommended to complete detection on the same day after staining whenever possible... Read More | Product IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized stateProduct IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized state, it appears purple-blue and non-fluorescent, while in the reduced state, it turns into a reduction product with pink or red fluorescence, with an absorption peak of 530-560nm and an emission peak of 590nm.In the process of cell proliferation, the ratios of NADPH/NADP, FADH/FAD, FMNH/FMN and NADH/NAD in the cell increase and are in a reducing environment. The dye taken into the cell is reduced by these metabolic intermediates and cytochromes and then released outside the cell and dissolved in the culture medium, changing the culture medium from non-fluorescent indigo blue to fluorescent pink. Finally, use an ordinary spectrophotometer or fluorophotometer for detection, and the absorbance and fluorescence intensity are proportional to the number of active cells.Instructions1. Add 10µl of detection reagent to 100µl of cell suspension, and incubate in a cell incubator for 2-6 hours. The color of the medium changes from indigo blue to pink and you can proceed to the next step.2. It is recommended to use a fluorescence microplate reader for detection, the excitation light wavelength is between 530-560 nm, the emission light wavelength is 590 nm, and the relative fluorescence unit (RFU) is recorded.3. Draw a standard curve or cell growth curve: the ordinate (Y axis) is the relative fluorescence unit (RFU); the abscissa (X axis) is the cell number or time point or drug concentration.Precautions1. The appropriate density of cells can increase the detection sensitivity. For 96-well plates, we recommend seeding 100 microliters of cells per well. The cell concentration range is: 100-10,000/well for adherent cells, 2,000-50,000/well for suspension cells, and medium as a blank control. For 384-well plates, the cell concentration and seeding volume are both halved.2. The whole process should be aseptic operation, because microbial contaminants can also reduce the detection reagents and affect the experimental results.3. Pay attention to the concentration of inoculated cells and the incubation time after adding detection reagents. If the cell concentration is too high or the incubation time is too long, it will cause a secondary reduction reaction, resulting in colorlessness and disappearance of fluorescence.4. When incubating, avoid light.5. This product can use fluorescence or spectrophotometric detection, but the sensitivity of fluorescence is high, and the experimental error is small. Fluorescence detection is recommended... Read More | This kit is used to extract miRNAs from various animal tissues, plant tissues and cells. The extracted miRNA molecule is complete and high purity, which is suitable for various molecular biology experiments such as Northern blot, real timepcr, miRNA microarray chip, in situ hybridization, This kit is used to extract miRNAs from various animal tissues, plant tissues and cells. The extracted miRNA molecule is complete and high purity, which is suitable for various molecular biology experiments such as Northern blot, real timepcr, miRNA microarray chip, in situ hybridization, RNase protection assay, etcComposition:Scope of application：Nucleic acid extraction and purificationInstruction：1.Experimental preparation：1.1.All reagents were prepared with DEPC-treated solvents. Please use RNase-free tip and centrifuge tube to avoid RNA degradation by RNase during extraction.1.2.70 % ethanol, -20C pre-cooling.2.Operational procedure：There is a slight difference in the operation of miRNA extraction from different samples. The specific steps are as follows :【 Extraction of miRNA from animal tissues】1.Take 20-40 mg tissue, transfer to a pre-cooled mortar, and add liquid nitrogen to grind into powder.Please click below to describe the amount of organization used :①RNA-rich tissue ( e.g. liver ) : no more than 30 mg②Tissues with low RNA content ( e.g., muscle ) : no more than 100 mg③When the amount of tissue used was less than 20 mg : the amount of R-I, R-II and isopropanol used was halved.④When the amount of tissue used was more than 40 mg : the use of R-I, R-II and isopropanol increased proportionally.2.Add 400 ul Buffer R-I, repeatedly aspirate 8-10 times with a syringe equipped with a 21-25 needle, and transfer to a 1.5 m : centrifuge tube ( provided in the kit ). 3.Add 150 µl BufferR-1l, swirl for 15-30 s, centrifuge at 12,000 X g for 5 min. [ Centrifugation at 4 °C is recommended ] 4.Take the supernatant to 1.5ml centrifuge tube, add 180 u anhydrous ethanol, mix evenly.5.The preparation tube was placed in a 2 m : centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and 12,000 X g was centrifuged for 1 min. [ 1 Centrifugation at 4 °C is recommended ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]6.Abandon the preparation tube, add 500µl isopropanol to the filtrate, and mix evenly.7.12,000Xg centrifuged for 10 min, discard the supernatant.8.Add 700µl 70 % ethanol ( pre-cooled at -20 °C ), centrifuged at 12,000Xg for 5min.9.The supernatant was discarded and dried at room temperature for 5-10 min.10.70 ul Buffer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute miRNA.【 Extraction of miRNA from plant tissue 】1.Take 30-150 mg tissue, transfer to a pre-cooled mortar, and add liquid nitrogen to grind into powder.Please click below to describe the amount of organization used :①Plant leaves : usually 10-80 mg② Plant fiber tissue : usually 100-150 mg③When the amount of plant leaf tissue was less than 30 mg : the amount of R-I, R-II and isopropyl alcohol used was halved.④When the amount of plant leaf tissue was more than 80 mg : the use of R-I, R-II and isopropanol increased proportionally.⑤When the amount of plant fiber tissue was more than 150 mg : the use of R-I, R-II and isopropanol increased proportionally.2.Add 400 ul BufferR-I, use a syringe with a 21-25 needle to repeatedly suck 8-10 times, and transfer to a 1.5mI centrifuge tube ( provided in the kit ). 3.Add 150 ul Buffer R-1I, vortex oscillation 15-30 s, 12.000 x g centrifugation 5 min. [ Centrifugation at 4 °C is recommended ]4.Take the supernatant to 1.5ml centrifuge tube, add 180 mountain anhydrous ethanol, mix evenly.The preparation tube was placed in a 2 mI centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and 12.000 xg was centrifuged for 1 min. It is recommended to centrifuge at 4 °C ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]Abandon the preparation tube, add 500µl isopropanol to the filtrate, and mix evenly.7.12,000xg high heart for 10 min, discard the supernatant.8.Add 700 ul 70 % ethanol ( -20 °C precooling ), 12,000 xg centrifuge for 5 min.9.The supernatant was discarded and dried at room temperature for 5-10 min.10.70 ul Buffer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute miRNA.【miRNA extraction from cells】Steps 1-3 According to the different ways of cell culture, two experimental methods, a or b, can be selected.a. Suspension cultured animal cells or cell suspension obtained from petri dishes or culture flasks or freshly isolated animal tissue single cell suspension :1a.Collect 2X 10 * -1X 10 ' cells, centrifuge 2,000Xg for 5 min, discard the supernatant ;2a. Add 400 µl Buffer R-I, repeatedly draw 8-10 times with a syringe containing 21-25 needles, and transfer to a 1.5 mI centrifuge tube ( provided in the kit ) ;3a. Add 150µl Buffer R1I, vortex oscillation 15-30s, 12.000Xg centrifugal 5min. [ build at 4 °C centrifugal ].b. Cells cultured on 96-well L, 24-well, 12-well or 6-well plates :Cells were collected from 96-well, 24-well, 12-well or 6-well culture plates, and the medium was discarded as much as possible, and 400 u / well Buffer R-I was added to each well, and the pipette gun was used to blow up and down 8-10 times ;2b.Transfer the above cell suspension to a 1.5ml centrifuge tube ( provided in the kit ), and repeatedly draw 8-10 times with a syringe containing 21-25 needles ;3b. Add 150 µl Bufflr R-II, swirl for 15-30 s, centrifuge for 5 min at 12,000 × g. [ Recommended at 4 °C ]4.Take the supernatant to 1.5ml centrifuge tube, add 180 mountain anhydrous ethanol, mixing evenly.5.The preparation tube was placed in a 2 ml centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and centrifuged at 12.000 Xg for 1 min. [ 1 Centrifugation at 4 °C is recommended ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]6.Abandon the preparation tube, add 500 u of isopropanol to the filtrate, and mix evenly.7.12,000Xg high heart for 10 min, discard the supernatant.8.Add 700µ70 % ethanol ( pre-cooled at − 20 °C ), centrifuged at 12,000 × g for 5 min.9.Abandon the supernatant, dry at room temperature for 5 - 10 min.10.70 ul Bufer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute mRNA.3.Flow chartMatters needing attention：Buffer R-I contains irritating compounds, when operating to wear latex gloves and glasses, to avoid contamination of the skin, eyes and clothes, be careful not to inhale the nose and mouth. If the skin, eyes, to immediately rinse with a lot of water or saline, if necessary, seek medical advice... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire |