| Description | Inquire | DescriptionIt contains a set of seven different homogeneous palladium catalysts, useful for rapid screening of catalysis conditions. It is in sampler format with individual components packaged for multiple experiments and mini scale-up. The cost of the kit is less than the total cost of individual DescriptionIt contains a set of seven different homogeneous palladium catalysts, useful for rapid screening of catalysis conditions. It is in sampler format with individual components packaged for multiple experiments and mini scale-up. The cost of the kit is less than the total cost of individual components.Catalysis Screening Kits... Read More | Inquire | This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. Purified lactose antibodies were coated on a microplate to produce solid-phase antibodies. Lactose was added to the microplate of the coated monoclonal antibody, along with HRP labeled lactose antigens, to compete for binding. After thorough washing, the substrate TMB was added for colorimetry. The depth of sample color is negatively correlated with the content of lactose in the sample. Measure the absorbance (OD value) at a wavelength of 450nm using an enzyme-linked immunosorbent assay (ELISA) reader, and calculate the content of lactose in the sample through a standard curve.Kit composition:130times concentrated washing solution20ml×1 bottle8.1Standard S1（80µg/L）0.5ml×1bottle2Enzyme-linked immunosorbent assay6ml×1 bottle8.2Standard S2（40µg/L）0.5ml×1bottle3Enzyme labeling coated plate96 holes x 1 pieces8.3Standard S3（20µg/L）0.5ml×1bottle4Color reagent A solution6ml×1 bottle8.4Standard S4（10µg/L）0.5ml×1bottle5Color developer B solution6ml×1 bottle8.5Standard S5（5µg/L）0.5ml×1bottle6Stop solution6ml×1 bottle9Instructions1 copy7Sample Diluent6ml×1 bottle10Microplate Sealers2 sheetsSpecimen requirements:1. Specimen processing:(1) After collecting the water sample, it is repeatedly freeze-thawed three times at -20 ℃, and then filtered through glass fiber for future reference(2) The tissue samples should be extracted using butanol: methanol: water (5:25:70 V: V: V), or extracted according to relevant literature. The experiment should be conducted as soon as possible after extraction. If the experiment cannot be conducted immediately, the specimen can be stored at -20 ℃ for future reference2. Samples containing NaN3 cannot be detected as NaN3 inhibits the activity of horseradish peroxidase (HRP).Operation steps:1. Sample addition: Set up standard wells, blank wells (blank control wells do not include samples and enzyme-linked immunosorbent assay reagents, the other steps are the same), and sample wells to be tested. Add 50 microliters to the standard well on the enzyme-linked immunosorbent assay (ELISA) plate, and first add 40 diluents to the sample well to be tested µ l. Then add 10 more samples to be tested µ L (The final dilution of the sample is 5 times). Add the sample to the bottom of the enzyme-linked immunosorbent assay (ELISA) plate well, avoiding touching the well wall as much as possible. Gently shake and mix well.2. Enzyme addition: Add 50 enzyme labeled reagents to each well µ l. Excluding blank holes.3. Warm incubation: Seal the plate with a sealing film and incubate at 37 ℃ for 60 minutes.4. Solution preparation: Dilute 30 times the concentrated washing solution with distilled water and set aside for later use5. Washing: Carefully remove the sealing film, discard the liquid, shake dry, fill each well with washing solution, let it stand for 30 seconds, then discard. Repeat this process 5 times and pat dry.6. Color development: Add color development agent A50 to each well first µ l. Add color developer B50 again µ l. Gently shake and mix well, and develop color at 37 ℃ in the dark for 15 minutes7. Termination: Add 50% termination fluid to each hole µ l. Terminate the reaction (at this point, the blue color immediately turns yellow).8. Measurement: Zero the blank hole and sequentially measure the absorbance (OD value) of each hole at a wavelength of 450nm. The measurement should be conducted within 15 minutes after adding the termination solution.Calculation:Draw a standard curve on a coordinate paper with the concentration of the standard substance as the x-axis and the OD value as the y-axis. Based on the OD value of the sample, determine the corresponding concentration from the standard curve; Multiply it by the dilution factor; Alternatively, a linear regression equation can be used to calculate the standard curve using the concentration and OD value of the standard substance. The OD value of the sample can be substituted into the equation to calculate the sample concentration, which is then multiplied by the dilution factor to obtain the actual concentration of the sample.Notes:1. The kit should be balanced at room temperature for 15-30 minutes before use when taken out from the cold storage environment. If the enzyme coated plate is not used up after opening, the Flat noodles should be stored in a sealed bag.2. Concentrated detergent may precipitate crystals. When diluted, it can be heated in a water bath to aid in dissolution. Washing does not affect the results.3. A sampler should be used for each step of sample addition, and its accuracy should be regularly calibrated to avoid experimental errors. It is best to control the sample addition time within 5 minutes. If there are a large number of specimens, it is recommended to use a firing gun for sample addition.4. Please make a standard curve at the same time as each measurement, preferably with a re hole. If the content of the substance to be tested in the sample is too high (the OD value of the sample is greater than the OD value of the first well of the standard well), please dilute the sample diluent by a certain multiple (n times) before measurement. When calculating, please multiply the total dilution multiple (x n x 5).5. The sealing film is only for one-time use to avoid cross contamination.6. Please store the substrate in dark.7. Strictly follow the instructions and determine the test results based on the reading of the enzyme-linked immunosorbent assay (ELISA) reader8. All samples, washing liquids, and various waste should be treated as infectious substances.9. The components of this reagent with different batch numbers shall not be mixed.Detection range:two µ G/L-90 µ G/L... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |