| Description | Animal liver and kidneys are the main organs for amino acid metabolism. Therefore, changes in urinary amino acids best reflect the physiological state of the liver and kidneys. Additionally, amino acid levels can indicate conditions such as burns and typhoid fever. The amino acid content in plants Animal liver and kidneys are the main organs for amino acid metabolism. Therefore, changes in urinary amino acids best reflect the physiological state of the liver and kidneys. Additionally, amino acid levels can indicate conditions such as burns and typhoid fever. The amino acid content in plants is significant for studying nitrogen metabolism changes under different conditions and during various growth and development stages, as well as for understanding nitrogen absorption, transport, assimilation, and nutritional status in plants.Detection Principle: The α-amino group of amino acids reacts with ninhydrin hydrate to produce a blue-purple compound with a characteristic absorption peak at 570 nm. The amino acid content is calculated by measuring the absorbance at 570 nm.Detection Range: 0.625 - 40 µmol/mLSensitivity: 0.5 µmol/mLApplicable Samples: Serum (plasma), animal/plant tissues, cells, cell culture supernatants, bacteria, urineG1501758Component96TStorageG1501758AExtraction Buffer100 mL2-8℃G1501758BAssay Buffer10 mL2-8℃G1501758CSubstrate1EA2-8℃. Store in the dark.G1501758DStandard (10mg Cysteine)1EA2-8℃. Store in the dark.User-Prepared Instruments and ReagentsMicroplate reader or visible spectrophotometer (capable of measuring absorbance at 570 nm)96-well plate or micro glass cuvettes, adjustable micropipettes and tipsRefrigerated centrifuge, water bathDeionized water, EthanolHomogenizer (for tissue samples)Experimental Procedure1. Reagent PreparationReagent NameReagent PreparationNotesExtraction BufferReady-to-use; Equilibrate to room temperature before use.Store at 4°C.Assay BufferReady-to-use; Equilibrate to room temperature before use.Store at 4°C. Toxic and irritant. Perform experiments in a fume hood.SubstrateToxic and irritant. Perform experiments in a fume hood.Working SubstratePrepare before use: Dissolve in 4 mL of 95% Ethanol.Unused dissolved substrate can be stored at 4°C protected from light for one week. For long-term storage, aliquot and store at -20°C protected from light for one month. Avoid repeated freeze-thaw cycles.StandardPrepare before use: Add 2.066 mL deionized water to dissolve completely, resulting in a 40 µmol/mL stock.Unused dissolved standard can be stored at 4°C for one week. For long-term storage, aliquot and store at -20°C for one month. Avoid repeated freeze-thaw cycles.2. Standard Curve SetupDilute the 40 µmol/mL standard stock solution with deionized water to concentrations of 20, 10, 5, 2.5, 1.25, and 0.625 µmol/mL as shown in the table below.TubeStandard VolumeDeionized Water Volume (µL)Standard Concentration (µmol/mL)Std.1200µL of 40µmol/mL040Std.2100µL of Std.110020Std.3100µL of Std.210010Std.4100µL of Std.31005Std.5100µL of Std.41002.5Std.6100µL of Std.51001.25Std.7100µL of Std.61000.625Note: The standard curve must be generated with each experiment. Diluted standard solutions are unstable and must be used within 4 hours.3. Sample PreparationNote: Fresh samples are recommended. If not used immediately, samples can be stored at -80°C for up to one month.3.1 Animal TissueWeigh approximately 0.1 g of tissue. Add 1 mL of Extraction Buffer and homogenize thoroughly at room temperature. Transfer the homogenate to a 1.5 mL microcentrifuge tube. Cap tightly (to prevent moisture loss) and incubate in a boiling water bath for 15 minutes. Cool with tap water. Centrifuge at 10,000 rpm for 10 minutes at room temperature. Collect the supernatant for assay.3.2 Plant TissueWeigh approximately 0.1 g of tissue. Add 1 mL of Extraction Buffer and grind. Sonicate for 5 minutes at room temperature (power 20% or 200W, pulse 3s on, 7s off, repeat 30 times). Transfer to a 1.5 mL microcentrifuge tube. Cap tightly (to prevent moisture loss) and incubate in a boiling water bath for 15 minutes. Cool with tap water. Centrifuge at 10,000 rpm for 10 minutes at room temperature. Collect the supernatant for assay.3.3 Cells or BacteriaCollect 5 million cells or bacteria into a centrifuge tube. Wash cells with cold PBS, centrifuge, and discard the supernatant. Add 1 mL of Extraction Buffer. Sonicate for 5 minutes at room temperature (power 20% or 200W, pulse 3s on, 7s off, repeat 30 times). Transfer to a 1.5 mL microcentrifuge tube. Cap tightly (to prevent moisture loss) and incubate in a boiling water bath for 15 minutes. Cool with tap water. Centrifuge at 10,000 rpm for 10 minutes at room temperature. Collect the supernatant for assay.3.4 Serum (Plasma), Cell Culture Supernatant, Urine, and Other LiquidsPipette 0.5 mL of the liquid sample and add 0.5 mL of Extraction Buffer. Cap tightly (to prevent moisture loss) and incubate in a boiling water bath for 15 minutes. Cool with tap water. Centrifuge at 10,000 rpm for 10 minutes at room temperature. Collect the supernatant for assay.Note: If protein concentration measurement is required, use Aladdin's BCA Protein Quantification Kit (B665595) or Ready-to-Use BCA Protein Quantification Kit (R1491648).4. Assay Steps4.1 Preheat the microplate reader or visible spectrophotometer for at least 30 minutes. Set the wavelength to 570 nm. For spectrophotometers, zero the instrument with deionized water.4.2 Sample Measurement (Add reagents sequentially into microcentrifuge tubes as below):ReagentBlank Tube (µL)Standard Tube (µL)Test Tube (µL)Deionized Water1000Standard (various conc.)0100Sample0010Working Substrate202020Assay Buffer5050504.3 Mix well and cap the tubes tightly (to prevent moisture loss). Incubate in a boiling water bath for 5 minutes. Cool in tap water for 10 seconds. Add 120 µL of 60% ethanol to each tube and invert several times to mix. Transfer 150 µL from each tube to the corresponding wells of a 96-well plate or micro glass cuvette. Measure the absorbance at 570 nm, recorded as A blank, A standard, and A test. Calculate ΔA test = A test - A blank and ΔA standard = A standard - A blank (The blank tube only needs to be prepared once). All measurements must be completed within 30 minutes after color development. Note:It is recommended to perform a preliminary test with 2-3 samples expected to have significant differences before the formal experiment. If A <sub> test </sub> is greater than 2.0, dilute the sample further with deionized water and multiply the result by the dilution factor.Proline and hydroxyproline do not produce an absorption peak at 570 nm when reacting with ninhydrin. Therefore, the results measured at 570 nm do not include these two amino acids.5. Calculation of ResultsNote: We provide two formulas, including the derived formula and a simplified version. They are equivalent. It is recommended to use the simplified formula in bold for final calculation.5.1 Standard Curve PlottingPlot the standard concentration (y-axis) against ΔA standard (x-axis) to generate the standard curve. Substitute ΔA test into the standard curve equation to calculate y (µmol/mL).5.2 Sample Amino Acid Content Calculation(1) Based on Sample WeightAmino Acid Content (µmol/g weight) = y ÷ (W ÷ V<sub>extraction</sub>) × n = y ÷ W × n(2) Based on Protein ConcentrationAmino Acid Content (µmol/mg prot) = y ÷ Cpr × n(3) Based on Bacterial or Cell CountAmino Acid Content (µmol/10⁴ cells) = y ÷ (Count ÷ V<sub>extraction</sub>) × n = y ÷ 500 × n = 0.002 × y × n(4) Based on Liquid VolumeAmino Acid Content (µmol/mL) = y × 2 × nParameter Definitions:W: Sample weight (g)V extraction : Volume of Extraction Buffer added (1 mL)n: Sample dilution factorCpr: Protein concentration of the supernatant (mg/mL)500: Total number of bacteria or cells (5 million)2: Dilution factor for liquid samples [(0.5 mL sample + 0.5 mL Buffer) / 0.5 mL sample = 2]6. Representative ResultsTypical Standard Curve: y = 20.349x - 0.423, R² = 0.9971 Figure 1: Total Amino Acid Standard Curve Precautions1. Biochemical reagents are generally irritating, biologically toxic, etc. For your safety and health, please use appropriate biosafety precautions throughout the experiment, including wearing lab coats, masks, gloves, head covers, etc. Perform experiments in a fume hood or biosafety cabinet.2. This product is for research use only. Not for use in clinical diagnosis... Read More | When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in genomic DNA, a large number of sticky 3'-oh ends will be generated, which can interact with YF under the catalysis of deoxyribonucleotide terminal transferase (TDT) ®/ CY dUTP binding can directly detect apoptotic cells by fluorescence microscopy or flow cytometry. This kind of method is called terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL). Because normal or proliferating cells have almost no DNA breaks, there is no 3'-oh formation and they can rarely be stained. TUNEL method can stain intact single apoptotic nuclei or apoptotic bodies in situ, can accurately reflect the typical biochemical and morphological characteristics of apoptosis, and can detect a very small number of apoptotic cells, so it is widely used in the study of apoptosis. This kit has a wide range of applications and can be used to detect apoptosis in frozen or paraffin sections, as well as cultured adherent cells or suspended cells. It can selectively detect apoptotic cells, but not necrotic cells or cells with DNA strand breaks caused by irradiation and drug treatment. This kit detects cell apoptosis with a short time-consuming, one-step staining reaction and can be detected after washing.Composition: Composition 20T 50T A. aladdin®640 TUNEL Reaction Buffer 1 mL 2 ×1.25 mL B. TdT Enzyme 20 µL 50 µL C. Proteinase K (2 mg/mL) 40 µL 100 µL D. DNase I (2 U/µL) 5 µL 13 µL E. 10 ×DNase I Buffer 100 µL 260 µL Product parameters：642/662 nm； Instruction： Experimental materials (self provided)PBS buffer (1 x, pH~7.4). 0.2% Triton X -100 (PBS formulation). 0.1% Triton X -100 (PBS formulation, containing 5 mg/mLBSA)4% paraformaldehyde (prepared with PBS)Immunohistochemical penDewaxing solvent (paraffin section sample)Related reagents for paraffin section processingAnti fluorescence quenching and sealing agent. ddH2Oexperimental design. A. Positive control:Prepare positive control slides using DNaseI treatment. DNaseI can digest single or double stranded DNA and expose the 3 '- OH end, artificially causing cell apoptosis. One experiment per time is sufficient. (To verify if there are any issues with the experimental operation and reagent kit)B. Negative control:Use TUNEL Reaction Buffer without TdT Enzyme and replace TdT Enzyme with ddH2O. (Mainly to exclude non-specific staining caused by cell apoptosis, operational processes, and other reasons; and to adjust the exposure intensity of the shooting.)C. Experimental processing group.The experimental group operated normally according to the instructions.D. Experimental control group.The experimental group operated normally according to the instructions.Experimental steps1. Sample preparation:(1) For adherent cells or cell smearsa. Clean once with PBS.Note: If you are concerned that the cells on the cell smear may not adhere firmly, you can dry the sample to make the cells adhere more firmly.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at 4 ℃ for 30 minutes. Clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Clean twice with PBS.d. Step 2: TUNEL reaction.(2) For suspended cells or cell suspensionsa. Collect cells (3-5 x 106 cells), centrifuge at 1000 rpm for 5 minutes, and wash twice with PBS.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and resuspend the cells thoroughly. Fix at 4 ℃ for 30 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.d. Step 2: TUNEL reaction.(3) Paraffin tissue sectioninga. Dewaxing and hydration: Place the sliced samples sequentially in xylene I (10 min) → xylene II (10 min) → 100% ethanol I (5 min) → 100% ethanol II (5 min) → 95% ethanol (5 min) → 90% ethanol (5 min) → 80% ethanol (5 min) → 70% ethanol (5 min) → ddH2O rinse for 5 min, rinse twice.Note: Xylene is toxic and volatile. Please perform this operation in a fume hood.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(4) Frozen tissue sectionsa. Fixation: Take out frozen sections and warm them back to room temperature. Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at room temperature for 30 minutes. Wash twice with PBS for 10 minutes each time.Note: If you are concerned that formaldehyde cleaning may not be clean enough, it may affect the final dyeing effect. After formaldehyde fixation is completed, an appropriate amount of 2 mg/mL glycine can be added and washed for 10 minutes to neutralize the residual fixing solution, and then PBS cleaning can be carried out.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(5) Positive treatment (only the positive control is subjected to this step, and other samples are directly subjected to the TUNEL reaction step)a. Dilute 10 x DNase I Buffer with ddH2O in a ratio of 1:10 to 1 x DNase I Buffer for later use.b. Drip 100 µ L of 1xDNase I Buffer onto the processed sample, covering all sample areas, and equilibrate at room temperature for 5 minutes.c. Dilute DNase I (2 U) with 1 x DNase I Buffer at a ratio of 1:100/ µ L) A working solution with a final concentration of 20 U/mL.d. Discard the buffer and add 100 µ Incubate DNase I working solution with a concentration of 20 U/mL at room temperature for 10 minutes.e. Discard DNase I working solution and clean twice with PBS.f. Step 2: TUNEL reaction.2. TUNEL reaction(1) Prepare TUNEL reaction solution (ready to use): / 1 sample 5 sample 10 sample TdT enzyme 1 µL 5 µL 10 µL YF®488/555/594/640 TUNEL Reaction Buffer 49 µL 245 µL 490 µL TUNEL Total volume of reaction solution 50 µL 250 µL 500 µL (2) For adherent cells, cell smears, or tissue sectionsa. Add 50 to each sample µ L TUNEL reaction solution, evenly cover the sample with the reaction solution. The appropriate time for dark incubation at 37 ℃ (recommended staining time for cells is 30 minutes to 1 hour, and tissue staining time is 2 hours).Note: 50 µ L TUNEL reaction solution is suitable for smear, slicing, or 96 well plates (other different well plates can adjust the volume of TUNEL reaction solution appropriately to cover cells). If the sample to be tested is a smear, slice, or in a 24 well plate, 12 well plate, or 6 well plate, anti evaporation film can be used, or self sealing bags or other appropriate materials can be used to cut circular plastic sheets slightly smaller than the holes. After adding TUNEL reaction solution dropwise, cover the sample to prevent the evaporation of TUNEL reaction solution and make the TUNEL reaction solution evenly cover the sample.b. Discard the TUNEL reaction solution, wash twice with PBS, and then wash three times with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mL BSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. (Optional) Add an appropriate concentration of 5 to each sample µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes. After staining, discard DAPI staining solution and wash twice with PBS for 5 minutes each time.d. (Optional) Slice sealing: Add 50 drops to each sample µ L anti fluorescence quenching sealing agent (anti fluorescence quenching sealing agent may not be suitable for certain dyes, it is recommended to conduct pre experimental testing for compatibility before the experiment), cover the cover glass, gently tap the cover glass with the blunt end of tweezers to remove bubbles and ensure complete sealing.e. Use filter paper to remove excess liquid and add 100 to the sample area µ Keep the sample moist with PBS and immediately observe under a fluorescence microscope.(3) For suspended cells or cell suspensionsa. Add 50 to each sample tube µ Gently resuspend cells in LTUNEL reaction solution and incubate at 37 ℃ in the dark for 30-1 hour. Gently resuspend cells with a micropipette every 15 minutes.b. Centrifuge at 2000 rpm for 5 minutes, discard TUNEL reaction solution, and wash twice with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mLBSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. Add 100 to each sample tube µ L concentration is 5 µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes.d. Join 400 µ L PBS resuspended cells and immediately detected with a flow cytometer or observed under a fluorescence microscope after smearing.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. when the staining background is heavy or non-specific staining is obvious, the staining time can be appropriately reduced. 3. it is recommended to add negative control and positive control groups during the experiment. 4. please wear mask and gloves when using component A. if it contacts the skin, please wash it with plenty of water immediately. 5. fluorescent dyes have quenching problems. Please try to avoid light to slow down fluorescence quenching. 6. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Late apoptosis detection, TUNEL Kit... Read More | Lipid peroxidation is the degradation of lipids that occurs as a result of oxidative damage and is a useful marker for oxidative stress. Polyunsaturated lipids are susceptible to an oxidative attack, typically by reactive oxygen species, resulting in a well-defined chain reaction with the productionLipid peroxidation is the degradation of lipids that occurs as a result of oxidative damage and is a useful marker for oxidative stress. Polyunsaturated lipids are susceptible to an oxidative attack, typically by reactive oxygen species, resulting in a well-defined chain reaction with the production of end products such as malondialdehyde (MDA). Lipid peroxidation may contribute to the pathology of many diseases including atherosclerosis, diabetes, and Alzheimer′s.Lipid peroxidation (MDA) assay kit has been used to determine the levels of malondialdehyde (MDA).Suitability: Suitable for the measurement of malondialdehyde (MDA) in a variety of samples including tissue, cells and plasmaPrinciple: In this kit, lipid peroxidation is determined by the reaction of MDA with thiobarbituric acid (TBA) to form a colorimetric (532 nm)/fluorometric (λex= 532/λem= 553 nm) product, proportional to the MDA present... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentNote: The amount of individual primers used is 1 µl, each N7-end primer can perform 10 DNA library constructs, and each kit can perform 240 DNA library constructs.Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Products contentNote: The amount of individual primers used is 1 µl, each N7-end primer can perform 10 DNA library constructs, and each kit can perform 240 DNA library constructs.Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes; Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. procedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol. Index N501 Primer for Illumina Index N901-N996 Primer for Illumina... Read More |